G240464



Basic Information


Item Value
gene id G240464
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 26674592 ~ 26675033 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU274804
CCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAATGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCCACAGAAGGCCTGGAAACACCTGCTGGTACTCGCTCCTCATATCCCC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU274804 True 442 TUCP 0.57 1 26674592 26675033
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110516273 NA coding downstream 24602 26647025 ~ 26649990 (-)
LOC110505173 NA coding downstream 37443 26636727 ~ 26637149 (-)
LOC110516190 fli1 coding downstream 52794 26608152 ~ 26621798 (-)
dhx16 LOC106582345 coding downstream 106962 26548090 ~ 26567630 (-)
LOC110516135 LOC106582343 coding downstream 126751 26541714 ~ 26547841 (-)
LOC110516285 LOC106582421 coding upstream 16705 26691738 ~ 26715464 (-)
LOC110505184 LOC106582443 coding upstream 54041 26729074 ~ 26736469 (-)
LOC110516341 LOC106582531 coding upstream 137433 26812466 ~ 26817929 (-)
LOC110516351 LOC106605237 coding upstream 156143 26831176 ~ 26881042 (-)
LOC110516494 NA coding upstream 258345 26933378 ~ 26939575 (-)
G240463 NA non-coding downstream 3691 26670628 ~ 26670901 (-)
G240458 NA non-coding downstream 7263 26667059 ~ 26667329 (-)
G240456 LOC106582397 non-coding downstream 10525 26662995 ~ 26664067 (-)
G240438 NA non-coding downstream 15244 26659071 ~ 26659348 (-)
G240450 NA non-coding downstream 36217 26638162 ~ 26638375 (-)
G240472 NA non-coding upstream 24248 26699281 ~ 26699605 (-)
G240497 NA non-coding upstream 87680 26762713 ~ 26763620 (-)
G240519 NA non-coding upstream 110392 26785425 ~ 26828419 (-)
G240574 NA non-coding upstream 182036 26857069 ~ 26857277 (-)
G240579 NA non-coding upstream 186729 26861762 ~ 26861967 (-)
G240409 NA other downstream 105070 26569101 ~ 26569522 (-)
LOC110515750 LOC106582146 other downstream 849835 25822812 ~ 25825108 (-)
LOC110515384 LOC106582009 other downstream 1438225 25171287 ~ 25236536 (-)
LOC110515208 LOC106581894 other downstream 1708384 24936516 ~ 25052970 (-)
LOC110515154 LOC106605289 other downstream 1904269 24767049 ~ 24799511 (-)
LOC110516631 LOC106582601 other upstream 396022 27070914 ~ 27097259 (-)
LOC110516667 LOC106582624 other upstream 437149 27111084 ~ 27127488 (-)
LOC110516678 LOC106605187 other upstream 480535 27154680 ~ 27159987 (-)
G240906 NA other upstream 509627 27184660 ~ 27185105 (-)
G242021 LOC106582922 other upstream 1580124 28205275 ~ 28256509 (-)

Expression


G240464 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G240464 Expression in each Bioproject

Bar chart with 15 bars.
G240464 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network