G240472



Basic Information


Item Value
gene id G240472
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 26699281 ~ 26699605 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU274815
aagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgtcgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctcatcaccctgaacacaccatccccactgtcaaacatggtggtggcagcaccatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctg

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU274815 True 325 lncRNA 0.45 1 26699281 26699605

Neighbor


gene id symbol gene type direction distance location
LOC110516273 NA coding downstream 49291 26647025 ~ 26649990 (-)
LOC110505173 NA coding downstream 62132 26636727 ~ 26637149 (-)
LOC110516190 fli1 coding downstream 77483 26608152 ~ 26621798 (-)
dhx16 LOC106582345 coding downstream 131651 26548090 ~ 26567630 (-)
LOC110516135 LOC106582343 coding downstream 151440 26541714 ~ 26547841 (-)
LOC110505184 LOC106582443 coding upstream 29469 26729074 ~ 26736469 (-)
LOC110516341 LOC106582531 coding upstream 112861 26812466 ~ 26817929 (-)
LOC110516351 LOC106605237 coding upstream 131571 26831176 ~ 26881042 (-)
LOC110516494 NA coding upstream 233773 26933378 ~ 26939575 (-)
LOC110516475 NA coding upstream 270793 26928593 ~ 26978577 (-)
G240463 NA non-coding downstream 28380 26670628 ~ 26670901 (-)
G240458 NA non-coding downstream 31952 26667059 ~ 26667329 (-)
G240456 LOC106582397 non-coding downstream 35214 26662995 ~ 26664067 (-)
G240438 NA non-coding downstream 39933 26659071 ~ 26659348 (-)
G240450 NA non-coding downstream 60906 26638162 ~ 26638375 (-)
G240497 NA non-coding upstream 63108 26762713 ~ 26763620 (-)
G240519 NA non-coding upstream 85820 26785425 ~ 26828419 (-)
G240574 NA non-coding upstream 157464 26857069 ~ 26857277 (-)
G240579 NA non-coding upstream 162157 26861762 ~ 26861967 (-)
G240588 NA non-coding upstream 174520 26874125 ~ 26874648 (-)
G240464 NA other downstream 24248 26674592 ~ 26675033 (-)
G240409 NA other downstream 129759 26569101 ~ 26569522 (-)
LOC110515750 LOC106582146 other downstream 874524 25822812 ~ 25825108 (-)
LOC110515384 LOC106582009 other downstream 1462914 25171287 ~ 25236536 (-)
LOC110515208 LOC106581894 other downstream 1733073 24936516 ~ 25052970 (-)
LOC110516631 LOC106582601 other upstream 371450 27070914 ~ 27097259 (-)
LOC110516667 LOC106582624 other upstream 412577 27111084 ~ 27127488 (-)
LOC110516678 LOC106605187 other upstream 455963 27154680 ~ 27159987 (-)
G240906 NA other upstream 485055 27184660 ~ 27185105 (-)
G242021 LOC106582922 other upstream 1555552 28205275 ~ 28256509 (-)

Expression


G240472 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G240472 Expression in each Bioproject

Bar chart with 21 bars.
G240472 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network