G241122



Basic Information


Item Value
gene id G241122
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 27523700 ~ 27523927 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU275527
CACAATTACAGGAACAATAATACGATAATAGTTGACCAGTATTGAATTGGTTACACAATTACAGGAACAATAATACGATAATAGTGGACCAGTTTTGAATTGGTTACACAATTACAGGAACAATAATACGATAATAGTTGACCAGTATTGAATTGGTTACACAATTACAGGAACAATAATACGATAATAGTTGACCAGTATTGAATTGGTTACACAATTACAGGAACA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU275527 True 228 lncRNA 0.31 1 27523700 27523927
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110516750 LOC106582677 coding downstream 289722 27229635 ~ 27233978 (-)
LOC110516735 LOC106582654 coding downstream 295197 27212189 ~ 27228503 (-)
lim2.5 LOC106605161 coding downstream 311930 27206115 ~ 27211770 (-)
LOC110516678 LOC106605187 coding downstream 363713 27154680 ~ 27159987 (-)
LOC110516655 LOC106582635 coding downstream 372042 27128099 ~ 27151658 (-)
LOC110516838 LOC106582709 coding upstream 340 27524267 ~ 27526325 (-)
LOC110516862 LOC106582717 coding upstream 18637 27542564 ~ 27549343 (-)
LOC110516872 LOC106582751 coding upstream 30102 27554029 ~ 27564456 (-)
LOC118944661 NA coding upstream 69142 27593069 ~ 27609600 (-)
LOC110516971 LOC106582842 coding upstream 87158 27611085 ~ 27658858 (-)
G241101 NA non-coding downstream 5845 27517605 ~ 27517855 (-)
G241100 NA non-coding downstream 6657 27510628 ~ 27517043 (-)
G241015 NA non-coding downstream 50718 27377482 ~ 27472982 (-)
G241050 NA non-coding downstream 99122 27424270 ~ 27424578 (-)
G240966 NA non-coding downstream 223370 27299943 ~ 27300330 (-)
G241126 NA non-coding upstream 3738 27527665 ~ 27527964 (-)
G241135 NA non-coding upstream 16436 27540363 ~ 27540616 (-)
G241311 NA non-coding upstream 17212 27541139 ~ 27541481 (-)
G241316 NA non-coding upstream 27434 27551361 ~ 27551675 (-)
G241317 NA non-coding upstream 28126 27552053 ~ 27552333 (-)
G240906 NA other downstream 338595 27184660 ~ 27185105 (-)
LOC110516667 LOC106582624 other downstream 411078 27111084 ~ 27127488 (-)
LOC110516631 LOC106582601 other downstream 438640 27070914 ~ 27097259 (-)
G240464 NA other downstream 848667 26674592 ~ 26675033 (-)
G242021 LOC106582922 other upstream 731230 28205275 ~ 28256509 (-)
LOC110517114 pnrc2 other upstream 751845 28275767 ~ 28280077 (-)
LOC110517222 NA other upstream 1195527 28719454 ~ 28725294 (-)
G242539 LOC106582989 other upstream 1203043 28726970 ~ 28730375 (-)
LOC110517244 LOC106582991 other upstream 1257673 28781383 ~ 28786278 (-)

Expression


G241122 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G241122 Expression in each Bioproject

Bar chart with 10 bars.
G241122 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network