G241318



Basic Information


Item Value
gene id G241318
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 27552827 ~ 27553106 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU275738
CACAGCTCCCACTTGTGAGTACATCAAATACAGCCCTGCTCCACAATTGCTAAGGTAGAAGGACTTTGTACTGTTGAGGAATGGTAGAAATCCTATTATAGTTATCCTCCAAAGCTAAATGACTGTCTGTTATTCCAAAAATTATAGGAATATGTCACGTAGGAAGACTCCATTGCCGACTGTACATGCTGATACTGCTCCTTTCCAGAATGAAATTTGCATGTACATTGAACGTGGTTGTTTTCCTCTCCTTCCATGATTTACTGTGTTTGCTGCAGCA

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU275738 True 280 lncRNA 0.41 1 27552827 27553106
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110516862 LOC106582717 coding downstream 3484 27542564 ~ 27549343 (-)
LOC110516838 LOC106582709 coding downstream 26502 27524267 ~ 27526325 (-)
LOC110516750 LOC106582677 coding downstream 318849 27229635 ~ 27233978 (-)
LOC110516735 LOC106582654 coding downstream 324324 27212189 ~ 27228503 (-)
lim2.5 LOC106605161 coding downstream 341057 27206115 ~ 27211770 (-)
LOC110516872 LOC106582751 coding upstream 923 27554029 ~ 27564456 (-)
LOC118944661 NA coding upstream 39963 27593069 ~ 27609600 (-)
LOC110516971 LOC106582842 coding upstream 57979 27611085 ~ 27658858 (-)
ago1 LOC106582818 coding upstream 106037 27659143 ~ 27682917 (-)
si:ch211-107n13.1 LOC106582885 coding upstream 216778 27769884 ~ 27787480 (-)
G241317 NA non-coding downstream 494 27552053 ~ 27552333 (-)
G241316 NA non-coding downstream 1152 27551361 ~ 27551675 (-)
G241311 NA non-coding downstream 11346 27541139 ~ 27541481 (-)
G241135 NA non-coding downstream 12211 27540363 ~ 27540616 (-)
G241126 NA non-coding downstream 24863 27527665 ~ 27527964 (-)
G241324 NA non-coding upstream 11562 27564668 ~ 27564888 (-)
G241371 NA non-coding upstream 78101 27631207 ~ 27631438 (-)
G241374 NA non-coding upstream 81197 27634303 ~ 27634514 (-)
G241376 NA non-coding upstream 83434 27636540 ~ 27636761 (-)
G240906 NA other downstream 367722 27184660 ~ 27185105 (-)
LOC110516678 LOC106605187 other downstream 394163 27154680 ~ 27159987 (-)
LOC110516667 LOC106582624 other downstream 440205 27111084 ~ 27127488 (-)
LOC110516631 LOC106582601 other downstream 467767 27070914 ~ 27097259 (-)
G240464 NA other downstream 877794 26674592 ~ 26675033 (-)
G242021 LOC106582922 other upstream 702051 28205275 ~ 28256509 (-)
LOC110517114 pnrc2 other upstream 722666 28275767 ~ 28280077 (-)
LOC110517222 NA other upstream 1166348 28719454 ~ 28725294 (-)
G242539 LOC106582989 other upstream 1173864 28726970 ~ 28730375 (-)
LOC110517244 LOC106582991 other upstream 1228494 28781383 ~ 28786278 (-)

Expression


G241318 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G241318 Expression in each Bioproject

Bar chart with 10 bars.
G241318 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network