G241376



Basic Information


Item Value
gene id G241376
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 27636540 ~ 27636761 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU275803
tgacacacatggaatcatgtagtaaccaaaaaagtgttaaacaaatcaaaactatcttcaaggtagccaccctttgccttgatgacagctttgcacactcttggcattctctcaaccagcttcatgaggttgtcatctggaatgcttttccagcagtctacaaggagttcccacatattctgagcgcttgttggctgcttttccttctctctgcggtccaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU275803 True 222 lncRNA 0.44 1 27636540 27636761
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118944661 NA coding downstream 26940 27593069 ~ 27609600 (-)
LOC110516872 LOC106582751 coding downstream 72084 27554029 ~ 27564456 (-)
LOC110516862 LOC106582717 coding downstream 87197 27542564 ~ 27549343 (-)
LOC110516838 LOC106582709 coding downstream 110215 27524267 ~ 27526325 (-)
LOC110516750 LOC106582677 coding downstream 402562 27229635 ~ 27233978 (-)
ago1 LOC106582818 coding upstream 22382 27659143 ~ 27682917 (-)
si:ch211-107n13.1 LOC106582885 coding upstream 133123 27769884 ~ 27787480 (-)
LOC110517114 pnrc2 coding upstream 639006 28275767 ~ 28280077 (-)
LOC110517198 LOC106582967 coding upstream 706983 28343744 ~ 28353662 (-)
LOC110517222 NA coding upstream 1082779 28719454 ~ 28725294 (-)
G241374 NA non-coding downstream 2026 27634303 ~ 27634514 (-)
G241371 NA non-coding downstream 5102 27631207 ~ 27631438 (-)
G241324 NA non-coding downstream 71652 27564668 ~ 27564888 (-)
G241318 NA non-coding downstream 83434 27552827 ~ 27553106 (-)
G241379 NA non-coding upstream 6342 27643103 ~ 27643322 (-)
G241385 NA non-coding upstream 18204 27654965 ~ 27732059 (-)
G241331 NA non-coding upstream 61681 27698442 ~ 27702160 (-)
G241438 NA non-coding upstream 113964 27750725 ~ 27751069 (-)
G241455 NA non-coding upstream 147101 27783862 ~ 27784079 (-)
G240906 NA other downstream 451435 27184660 ~ 27185105 (-)
LOC110516678 LOC106605187 other downstream 477876 27154680 ~ 27159987 (-)
LOC110516667 LOC106582624 other downstream 523918 27111084 ~ 27127488 (-)
LOC110516631 LOC106582601 other downstream 551480 27070914 ~ 27097259 (-)
G240464 NA other downstream 961507 26674592 ~ 26675033 (-)
G242021 LOC106582922 other upstream 618396 28205275 ~ 28256509 (-)
G242539 LOC106582989 other upstream 1090209 28726970 ~ 28730375 (-)
LOC110517244 LOC106582991 other upstream 1144839 28781383 ~ 28786278 (-)

Expression


G241376 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G241376 Expression in each Bioproject

Bar chart with 16 bars.
G241376 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network