G242607



Basic Information


Item Value
gene id G242607
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 28795001 ~ 28796190 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU277118
agcagaaggaagcttagcaaggggaatgaaatgagccgccttagagaacctatcgacaaccgtaagaataacagtcttccccgctgacgaaggcagtccggtgacaaaatctaaggcgatgtgagaccacggtcgagagggaataggaagcggcctgagacggccggcaggaggagagttaccggacttagtctgcgcgcagaccgaacaagcagccacgaaacgacgcgtgtcatgctcccgggtgggccaccaaaaacgctggcgaatggaagcaagcgtaccccgaacgccagggtggccggctaacttggcagagtgagcccactgaagaacggccagacgagtaggaacgggaacgaaaagaaggttcctaggacaagcgcgcggcgacggagtgtgagtgagcgcttgttttacctgcctctcaattccccagacagtcaacccgacaacacgcccctcagggagaatcccctcggggtcagtggaggctactgaagaactgaagagacgagataaagcatcaggcttggtgttcttagagcccggacgataagaaatcacgaactcgaaacgagcgaaaaacagcgcccaacgcgcctgacgcgcattaagtcgtttggcagaacggatgtactcaaggttcctatggtcagtccaaacgacaaaaggaacggtcgccccctccaaccactgtcgccattcgcctagggctaaccggatggcgagcagttcgcggttacccacatcatagttacgttccgacggcgacaggcgatgagaaaaatacgcgcatgggtggaccttgtcgtcagagagggagcgctgagaaagaatggctcccacgcccacctctgacgcgtcaacctcgacaacgaactgtctagagacgtcaggtgtaacaaggataggagcggatgtaaaacgattcttgaggagatcaaaagctccctgggcggaaacggaccacttaaagcacgtcttgacagaagtaagggctgtgagaggagctgccacctgaccgaaattacggatgaaacgatgatagaagttcgcgaagccgagaaagcgctgcagctcgacgcgtgacttagggacgggccaatcaatgacagcttggaccttagcgggatccatcttaatgccttcagcggaaataacagaaccgagaaatgtgacggaggagg

Function


NR:

description
Retrotransposable element Tf2 protein type 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU277118 True 1190 lncRNA 0.55 1 28795001 28796190
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110517244 LOC106582991 coding downstream 8723 28781383 ~ 28786278 (-)
LOC110517222 NA coding downstream 69707 28719454 ~ 28725294 (-)
LOC110517198 LOC106582967 coding downstream 441339 28343744 ~ 28353662 (-)
LOC110517114 pnrc2 coding downstream 514924 28275767 ~ 28280077 (-)
si:ch211-107n13.1 LOC106582885 coding downstream 1007521 27769884 ~ 27787480 (-)
rspo1 LOC106605132 coding upstream 95230 28891420 ~ 28921524 (-)
dnali1 dnali1 coding upstream 238738 29034928 ~ 29039438 (-)
LOC110517348 LOC106604987 coding upstream 399956 29196146 ~ 29201564 (-)
LOC110517416 LOC106605123 coding upstream 525841 29322031 ~ 29388582 (-)
stk40 LOC106583156 coding upstream 615998 29412188 ~ 29443132 (-)
G242585 NA non-coding downstream 21651 28773113 ~ 28773350 (-)
G242547 NA non-coding downstream 58613 28735882 ~ 28736388 (-)
G242367 NA non-coding downstream 190382 28604113 ~ 28604619 (-)
G242401 NA non-coding downstream 196497 28598187 ~ 28598504 (-)
G242657 NA non-coding upstream 33695 28829885 ~ 28833286 (-)
G242686 NA non-coding upstream 74190 28870380 ~ 28870630 (-)
G242687 NA non-coding upstream 75353 28871543 ~ 28871778 (-)
G242707 NA non-coding upstream 89279 28885469 ~ 28885674 (-)
G242747 NA non-coding upstream 115730 28911920 ~ 28912139 (-)
G242539 LOC106582989 other downstream 64626 28726970 ~ 28730375 (-)
G242021 LOC106582922 other downstream 538492 28205275 ~ 28256509 (-)
G242796 NA other upstream 149551 28945741 ~ 28946292 (-)
G243154 NA other upstream 336126 29132316 ~ 29152629 (-)
LOC110517486 LOC106583166 other upstream 660291 29456450 ~ 29458390 (-)
G244338 NA other upstream 1292653 30088843 ~ 30129214 (-)
G244379 NA other upstream 1377823 30174013 ~ 30177408 (-)

Expression


G242607 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G242607 Expression in each Bioproject

Bar chart with 20 bars.
G242607 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network