G242686



Basic Information


Item Value
gene id G242686
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 28870380 ~ 28870630 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU277198
cagagatctacagctgaggtgggagactctgtccaggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaacgaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaa

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU277198 True 251 lncRNA 0.41 1 28870380 28870630
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110517244 LOC106582991 coding downstream 84102 28781383 ~ 28786278 (-)
LOC110517222 NA coding downstream 145086 28719454 ~ 28725294 (-)
LOC110517198 LOC106582967 coding downstream 516718 28343744 ~ 28353662 (-)
LOC110517114 pnrc2 coding downstream 590303 28275767 ~ 28280077 (-)
si:ch211-107n13.1 LOC106582885 coding downstream 1082900 27769884 ~ 27787480 (-)
rspo1 LOC106605132 coding upstream 20790 28891420 ~ 28921524 (-)
dnali1 dnali1 coding upstream 164298 29034928 ~ 29039438 (-)
LOC110517348 LOC106604987 coding upstream 325516 29196146 ~ 29201564 (-)
LOC110517416 LOC106605123 coding upstream 451401 29322031 ~ 29388582 (-)
stk40 LOC106583156 coding upstream 541558 29412188 ~ 29443132 (-)
G242657 NA non-coding downstream 37094 28829885 ~ 28833286 (-)
G242607 NA non-coding downstream 74190 28795001 ~ 28796190 (-)
G242585 NA non-coding downstream 97030 28773113 ~ 28773350 (-)
G242547 NA non-coding downstream 133992 28735882 ~ 28736388 (-)
G242687 NA non-coding upstream 913 28871543 ~ 28871778 (-)
G242707 NA non-coding upstream 14839 28885469 ~ 28885674 (-)
G242747 NA non-coding upstream 41290 28911920 ~ 28912139 (-)
G242756 NA non-coding upstream 51673 28922303 ~ 28922506 (-)
G242757 NA non-coding upstream 52307 28922937 ~ 28923157 (-)
G242539 LOC106582989 other downstream 140005 28726970 ~ 28730375 (-)
G242021 LOC106582922 other downstream 613871 28205275 ~ 28256509 (-)
G242796 NA other upstream 75111 28945741 ~ 28946292 (-)
G243154 NA other upstream 261686 29132316 ~ 29152629 (-)
LOC110517486 LOC106583166 other upstream 585851 29456450 ~ 29458390 (-)
G244338 NA other upstream 1218213 30088843 ~ 30129214 (-)
G244379 NA other upstream 1303383 30174013 ~ 30177408 (-)

Expression


G242686 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G242686 Expression in each Bioproject

Bar chart with 11 bars.
G242686 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network