G250833 (ptpru)



Basic Information


Item Value
gene id G250833
gene name ptpru
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 35481017 ~ 35481293 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU286042
TGCTGATGAGGGGTGGTCCGGGTGGTCCGGTGCCGCCCTCTCCGGGCCGGGTCAGCAACACACTTATGTGATACTCCGTGTCTGGGTCCAGGTGCCACAGCTTGTAGGTGACCATGTTGACCCCATGGACCTCGGACCAAGGTGATTGGCTGGCCCGGTACTCAATCTCCTTCCTGATGATAGGGCCATCTCCCAGGATGGAGTTGGTGTTGAGCTGGATGATCAGATATGTGGAGCCCGCTCGCAGCAGCTGCGGGGGCGCAATAGGGGAGGGGGG

Function


symbol description
ptpru Enables beta-catenin binding activity and protein tyrosine phosphatase activity. Involved in several processes, including negative regulation of canonical Wnt signaling pathway; positive regulation of cell-cell adhesion mediated by cadherin; and protein localization to cell surface. Located in cell-cell junction.

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU286042 True 277 lncRNA 0.61 1 35481017 35481293

Neighbor


gene id symbol gene type direction distance location
si:dkey-34d22.1 LOC106584244 coding downstream 278074 35175483 ~ 35202943 (-)
taf12 taf12 coding downstream 305753 35169845 ~ 35175264 (-)
LOC118944512 NA coding downstream 390624 35089126 ~ 35090393 (-)
cited4b LOC106584212 coding downstream 428736 35049466 ~ 35052281 (-)
vegf vegf coding downstream 649789 34814879 ~ 34831228 (-)
LOC110519653 LOC106584320 coding upstream 621550 36102843 ~ 36109194 (-)
stmn1b LOC106584327 coding upstream 630894 36112187 ~ 36117544 (-)
LOC110519907 oprd1 coding upstream 955088 36436381 ~ 36437754 (-)
LOC110504056 NA coding upstream 1005582 36486875 ~ 36505339 (-)
tent5ba fam46b coding upstream 1062877 36544170 ~ 36568553 (-)
G250771 NA non-coding downstream 94384 35385653 ~ 35386633 (-)
G250770 NA non-coding downstream 95546 35385205 ~ 35385471 (-)
G250767 NA non-coding downstream 98246 35382498 ~ 35382771 (-)
G250766 NA non-coding downstream 98606 35382185 ~ 35382411 (-)
G250752 NA non-coding downstream 116116 35357516 ~ 35364901 (-)
G250855 NA non-coding upstream 32654 35513947 ~ 35514151 (-)
G250868 NA non-coding upstream 49807 35531100 ~ 35531422 (-)
G250879 NA non-coding upstream 65093 35546386 ~ 35546619 (-)
G250884 NA non-coding upstream 72124 35553417 ~ 35553715 (-)
G250892 NA non-coding upstream 82187 35563480 ~ 35563842 (-)
G249990 NA other downstream 584721 34895958 ~ 34896296 (-)
G249978 NA other downstream 591063 34889506 ~ 34889954 (-)
G249485 LOC106584080 other downstream 1121566 34357275 ~ 34359451 (-)
G248239 LOC106605043 other downstream 2061310 33419429 ~ 33419707 (-)
LOC110518371 LOC106583543 other downstream 3899815 31562384 ~ 31631107 (-)
G251462 LOC106584332 other upstream 658819 36140112 ~ 36144572 (-)
G251681 NA other upstream 876190 36357325 ~ 36357971 (-)
gpatch3 gpatch3 other upstream 1250552 36731832 ~ 36754332 (-)
LOC110519955 LOC106586057 other upstream 3917968 39399261 ~ 39508811 (-)
G255911 NA other upstream 4163278 39644571 ~ 39645743 (-)

Expression



Co-expression Network