G250911 (ptpru)



Basic Information


Item Value
gene id G250911
gene name ptpru
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 35590963 ~ 35591268 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU286120
AGTTGGACTGGTTGAGCTGGTTGAGCATGACCACCGAGGTGCAGCCGTAGTCGAACACCAACCTCCAGAAGTCGGCGGTGGTGCCGGGGAGCGGGTGAGGGGTGACGATGAAGGCGGCGGGCTGGTGGAAGCTGTCAGTGAGTGCCGCGTTGATGTAGTTGTTGCTCTCGCCCTCAGTGGTGACCAGGAATGCCAGGGCACGGTCAGGCGGCAGCACGTCCATGCTGCGGTTCTTCTCCCGGTTCCTGGGGAGCAGGGCGATGCTGCACTCCTCCACGTCCAGGTGAGGGGTGACCGAGTTCAACG

Function


symbol description
ptpru Enables beta-catenin binding activity and protein tyrosine phosphatase activity. Involved in several processes, including negative regulation of canonical Wnt signaling pathway; positive regulation of cell-cell adhesion mediated by cadherin; and protein localization to cell surface. Located in cell-cell junction.

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU286120 True 306 lncRNA 0.63 1 35590963 35591268

Neighbor


gene id symbol gene type direction distance location
si:dkey-34d22.1 LOC106584244 coding downstream 388020 35175483 ~ 35202943 (-)
taf12 taf12 coding downstream 415699 35169845 ~ 35175264 (-)
LOC118944512 NA coding downstream 500570 35089126 ~ 35090393 (-)
cited4b LOC106584212 coding downstream 538682 35049466 ~ 35052281 (-)
vegf vegf coding downstream 759735 34814879 ~ 34831228 (-)
LOC110519653 LOC106584320 coding upstream 511575 36102843 ~ 36109194 (-)
stmn1b LOC106584327 coding upstream 520919 36112187 ~ 36117544 (-)
LOC110519907 oprd1 coding upstream 845113 36436381 ~ 36437754 (-)
LOC110504056 NA coding upstream 895607 36486875 ~ 36505339 (-)
tent5ba fam46b coding upstream 952902 36544170 ~ 36568553 (-)
G250906 NA non-coding downstream 5457 35585260 ~ 35585506 (-)
G250902 NA non-coding downstream 10107 35580614 ~ 35580856 (-)
G250896 NA non-coding downstream 20997 35569749 ~ 35569966 (-)
G250894 NA non-coding downstream 24795 35565905 ~ 35566168 (-)
G250892 NA non-coding downstream 27121 35563480 ~ 35563842 (-)
G250964 NA non-coding upstream 78240 35669508 ~ 35669887 (-)
G250969 NA non-coding upstream 81006 35672274 ~ 35676936 (-)
G251042 NA non-coding upstream 131921 35723189 ~ 35724202 (-)
G251044 NA non-coding upstream 136547 35727815 ~ 35742651 (-)
G251048 NA non-coding upstream 153671 35744939 ~ 35802618 (-)
G249990 NA other downstream 694667 34895958 ~ 34896296 (-)
G249978 NA other downstream 701009 34889506 ~ 34889954 (-)
G249485 LOC106584080 other downstream 1231512 34357275 ~ 34359451 (-)
G248239 LOC106605043 other downstream 2171256 33419429 ~ 33419707 (-)
LOC110518371 LOC106583543 other downstream 4009761 31562384 ~ 31631107 (-)
G251462 LOC106584332 other upstream 548844 36140112 ~ 36144572 (-)
G251681 NA other upstream 766215 36357325 ~ 36357971 (-)
gpatch3 gpatch3 other upstream 1140577 36731832 ~ 36754332 (-)
LOC110519955 LOC106586057 other upstream 3807993 39399261 ~ 39508811 (-)
G255911 NA other upstream 4053303 39644571 ~ 39645743 (-)

Expression



Co-expression Network