G253392



Basic Information


Item Value
gene id G253392
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 37802608 ~ 37802882 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU288816
ccccagtgatgcgttgtgcagacctcactaccctctggagagccttacggttgagggcggagcagttgccgtaccaggcggtgatacagcccgccaggatgctctcgattgtgcatctgtagaagtttgtgagtgcttttggtgactagccaaatttcttcagcctcctgaggttgaagaggcgctgctgcgccttcttcacaatgctgtctgtgtgagtggaccaattcagtttgtctgtgatgtgtatgccgaggaacttaaaacttgctacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU288816 True 275 lncRNA 0.53 1 37802608 37802882
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110519942 LOC106586050 coding upstream 47156 37748695 ~ 37756709 (+)
si:ch211-184m13.4 LOC106586045 coding upstream 110710 37688788 ~ 37691898 (+)
LOC110519939 LOC106604981 coding upstream 313038 37428004 ~ 37489579 (+)
LOC110519936 LOC106586041 coding upstream 378272 37419106 ~ 37424336 (+)
LOC110519932 LOC106591969 coding upstream 1143055 36657467 ~ 36659553 (+)
LOC110519944 LOC106586047 coding downstream 431461 38234343 ~ 38250022 (+)
LOC110519946 NA coding downstream 833064 38635946 ~ 38760490 (+)
LOC110519950 LOC106586053 coding downstream 1369015 39171897 ~ 39214104 (+)
trnaf-gaa NA coding downstream 1590759 39393641 ~ 39393713 (+)
LOC110519956 LOC105026395 coding downstream 1805287 39608169 ~ 39621078 (+)
G253316 NA non-coding upstream 41214 37760786 ~ 37761394 (+)
G253305 NA non-coding upstream 50338 37729005 ~ 37752270 (+)
G253313 NA non-coding upstream 58176 37743965 ~ 37744432 (+)
G253022 NA non-coding upstream 163931 37638313 ~ 37638677 (+)
G253393 NA non-coding downstream 52 37802934 ~ 37803493 (+)
G253412 NA non-coding downstream 11875 37814757 ~ 37816542 (+)
G253418 LOC106586049 non-coding downstream 21532 37824414 ~ 37841104 (+)
G253496 NA non-coding downstream 129945 37932827 ~ 37933822 (+)
G253788 NA non-coding downstream 261432 38064314 ~ 38064525 (+)
G253299 NA other upstream 75270 37726948 ~ 37727338 (+)
G251845 zdhhc18 other upstream 1175066 36623610 ~ 36627542 (+)
G251773 NA other upstream 1277435 36511574 ~ 36579307 (+)
LOC110519579 gmeb1 other upstream 2581236 35203647 ~ 35221874 (+)
rab42b rab42 other upstream 2629145 35153546 ~ 35173463 (+)
G253834 LOC100136012 other downstream 289440 38092322 ~ 38092734 (+)
G254204 NA other downstream 638284 38441166 ~ 38441734 (+)
G254445 NA other downstream 797605 38600487 ~ 38600866 (+)
G254816 NA other downstream 1040628 38843510 ~ 38844556 (+)
LOC110519960 LOC106586058 other downstream 1856177 39658753 ~ 39668297 (+)

Expression


G253392 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G253392 Expression in each Bioproject

Bar chart with 13 bars.
G253392 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network