G253834 (LOC100136012)



Basic Information


Item Value
gene id G253834
gene name LOC100136012
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 38092322 ~ 38092734 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU289268
ctgtattaactgcacctgtttgaactcattacctgtataaaagacacctgtccacacactctatcaaacagactccaacctctccacaatggccaagaccagagagctgtgtaaggacatcaggaataaaattgtagacctgcacaaggctgggatgggctacaggacaaaaggcaagcagcttggtgagaaggcaacaactgttggcgcagttattagaaaatggaagaagttcaagatgacggtcaatcaccctcggtctgggactccatgcaagatctcacctcgtggggcatcaatgatcatgaggaaggtgagggatcagcccagaactacacggcaggacctggtcaatgacctgaagagagctgggaccacagtctcaaagaaaaccattagtaacacactacgcc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU289268 True 413 TUCP 0.48 1 38092322 38092734

Neighbor


gene id symbol gene type direction distance location
LOC110519942 LOC106586050 coding upstream 336870 37748695 ~ 37756709 (+)
si:ch211-184m13.4 LOC106586045 coding upstream 400424 37688788 ~ 37691898 (+)
LOC110519939 LOC106604981 coding upstream 602752 37428004 ~ 37489579 (+)
LOC110519936 LOC106586041 coding upstream 667986 37419106 ~ 37424336 (+)
LOC110519932 LOC106591969 coding upstream 1432769 36657467 ~ 36659553 (+)
LOC110519944 LOC106586047 coding downstream 141609 38234343 ~ 38250022 (+)
LOC110519946 NA coding downstream 543212 38635946 ~ 38760490 (+)
LOC110519950 LOC106586053 coding downstream 1079163 39171897 ~ 39214104 (+)
trnaf-gaa NA coding downstream 1300907 39393641 ~ 39393713 (+)
LOC110519956 LOC105026395 coding downstream 1515435 39608169 ~ 39621078 (+)
G253822 NA non-coding upstream 6857 38085241 ~ 38085465 (+)
G253800 NA non-coding upstream 20328 38071742 ~ 38071994 (+)
G253791 NA non-coding upstream 26393 38065720 ~ 38065929 (+)
G253789 NA non-coding upstream 27486 38064625 ~ 38064836 (+)
G253788 NA non-coding upstream 27797 38064314 ~ 38064525 (+)
G253835 NA non-coding downstream 37 38092771 ~ 38093215 (+)
G253860 NA non-coding downstream 18350 38111084 ~ 38112309 (+)
G253882 NA non-coding downstream 35131 38127865 ~ 38128068 (+)
G253905 NA non-coding downstream 44851 38137585 ~ 38137784 (+)
G253925 NA non-coding downstream 56139 38148873 ~ 38149092 (+)
G253299 NA other upstream 364984 37726948 ~ 37727338 (+)
G251845 zdhhc18 other upstream 1464780 36623610 ~ 36627542 (+)
G251773 NA other upstream 1567149 36511574 ~ 36579307 (+)
LOC110519579 gmeb1 other upstream 2870950 35203647 ~ 35221874 (+)
rab42b rab42 other upstream 2918859 35153546 ~ 35173463 (+)
G254204 NA other downstream 348432 38441166 ~ 38441734 (+)
G254445 NA other downstream 507753 38600487 ~ 38600866 (+)
G254816 NA other downstream 750776 38843510 ~ 38844556 (+)
LOC110519960 LOC106586058 other downstream 1566325 39658753 ~ 39668297 (+)
LOC110519969 LOC106586020 other downstream 2347335 40440040 ~ 40452542 (+)

Expression


G253834(LOC100136012) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G253834(LOC100136012) Expression in each Bioproject

Bar chart with 20 bars.
G253834(LOC100136012) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network