G261781



Basic Information


Item Value
gene id G261781
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 44239337 ~ 44239566 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU297777
gtaaaacaaacatacagtcaataatacagtataaacaagtcaaatcaaattttatttgtcacatacacatggttagcagatgttaatgcaagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataaccaacaagtaatctagctaacaattccaaaactactaccttatagacacaagtgtaaggggataaagaatatgtacataaagatatatgaatg

Function


NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU297777 True 230 lncRNA 0.32 1 44239337 44239566

Neighbor


gene id symbol gene type direction distance location
LOC110519998 LOC106586121 coding downstream 3449 44231999 ~ 44235888 (-)
LOC118956029 NA coding downstream 497535 43706881 ~ 43741802 (-)
LOC110519993 LOC106586116 coding downstream 613167 43521331 ~ 43626170 (-)
LOC110519985 LOC106586111 coding downstream 1187923 43015700 ~ 43051414 (-)
LOC110519987 LOC106586109 coding downstream 1235280 42946744 ~ 43004057 (-)
LOC118956139 NA coding upstream 19603 44259169 ~ 44262998 (-)
LOC110519999 LOC106586089 coding upstream 51260 44290826 ~ 44294051 (-)
LOC110520000 NA coding upstream 185802 44425368 ~ 44468711 (-)
LOC110520004 LOC106586125 coding upstream 284144 44523710 ~ 44718478 (-)
LOC118956426 NA coding upstream 699169 44938735 ~ 44940312 (-)
G261779 NA non-coding downstream 2716 44236418 ~ 44236621 (-)
G261711 NA non-coding downstream 22022 44201848 ~ 44217315 (-)
G261710 NA non-coding downstream 31266 44205471 ~ 44208071 (-)
G261680 NA non-coding downstream 92064 44147036 ~ 44147273 (-)
G261678 NA non-coding downstream 93324 44145775 ~ 44146013 (-)
G261792 NA non-coding upstream 12600 44252166 ~ 44252426 (-)
G261861 NA non-coding upstream 78989 44318555 ~ 44318760 (-)
G261863 NA non-coding upstream 79376 44318942 ~ 44319180 (-)
G261866 NA non-coding upstream 81397 44320963 ~ 44321334 (-)
G261867 NA non-coding upstream 81877 44321443 ~ 44321750 (-)
G261580 NA other downstream 207832 43989524 ~ 44031505 (-)
G259576 LOC106599288 other downstream 1911342 42285630 ~ 42327995 (-)
G259579 LOC106586070 other downstream 1919952 42290259 ~ 42319385 (-)
col6a3 LOC106598405 other downstream 1923979 42291728 ~ 42329627 (-)
G259259 sdpr other downstream 2471749 41763817 ~ 41767588 (-)
G262993 NA other upstream 770606 45010172 ~ 45012249 (-)
LOC110520012 cssa21h2orf88 other upstream 859774 45099333 ~ 45104286 (-)
G263274 NA other upstream 1296766 45536332 ~ 45537542 (-)
G265988 NA other upstream 3359652 47599218 ~ 47599815 (-)
LOC110505248 gcg other upstream 3792481 48032036 ~ 48033434 (-)

Expression



Co-expression Network