G263039



Basic Information


Item Value
gene id G263039
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 45078521 ~ 45078837 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU299126
accatgtttgacagtggggatggtgtgttcagagtgttgcttttacgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagttcatccagagtgatcatgag

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU299126 True 216 lncRNA 0.42 2 45078521 45078837

Neighbor


gene id symbol gene type direction distance location
LOC110520009 LOC106586132 coding downstream 92267 44964412 ~ 44986254 (-)
LOC110520006 LOC106581857 coding downstream 121178 44941359 ~ 44957343 (-)
LOC110520007 NA coding downstream 130703 44944721 ~ 44947818 (-)
LOC118956426 NA coding downstream 138209 44938735 ~ 44940312 (-)
LOC110520004 LOC106586125 coding downstream 360043 44523710 ~ 44718478 (-)
LOC110520012 cssa21h2orf88 coding upstream 20496 45099333 ~ 45104286 (-)
LOC110504133 NA coding upstream 100527 45179364 ~ 45190120 (-)
LOC118956634 NA coding upstream 118240 45197003 ~ 45200662 (-)
LOC110520013 LOC106586136 coding upstream 132108 45210945 ~ 45212683 (-)
LOC110520016 asnsd1 coding upstream 149413 45228250 ~ 45235027 (-)
G263012 NA non-coding downstream 37982 45040218 ~ 45040539 (-)
G263011 NA non-coding downstream 38993 45039251 ~ 45039528 (-)
G263006 NA non-coding downstream 43486 45034799 ~ 45035035 (-)
G262989 NA non-coding downstream 76977 45000542 ~ 45001544 (-)
G262668 NA non-coding downstream 117664 44960631 ~ 44960857 (-)
G263110 NA non-coding upstream 120382 45199219 ~ 45199584 (-)
G263109 NA non-coding upstream 134908 45213745 ~ 45214224 (-)
G263120 NA non-coding upstream 143217 45222054 ~ 45222436 (-)
G263119 NA non-coding upstream 145235 45224072 ~ 45224612 (-)
G262993 NA other downstream 66272 45010172 ~ 45012249 (-)
G261580 NA other downstream 1047016 43989524 ~ 44031505 (-)
G259576 LOC106599288 other downstream 2750526 42285630 ~ 42327995 (-)
G263274 NA other upstream 457495 45536332 ~ 45537542 (-)
G265988 NA other upstream 2520381 47599218 ~ 47599815 (-)
LOC110505248 gcg other upstream 2953210 48032036 ~ 48033434 (-)
G268310 NA other upstream 4416640 49495477 ~ 49495803 (-)

Expression


G263039 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G263039 Expression in each Bioproject

Bar chart with 11 bars.
G263039 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network