G263120



Basic Information


Item Value
gene id G263120
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 45222054 ~ 45222436 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU299220
CAGACCGCTCCATGGCCTCCTGTACAACATGGCCTACAATATGTTCTCTCTGTGGAGCCGCTGCGCAACAGTGGGAATAATCCGTCTAGTCCTACAATGAAATACAAAATCAGACCATCACTTCTGCTGGATGAACATGAACAAATTAACAAAATTATACCCACCTCTTTGTGTGAATGAAGAGATTCTCCAAGGATTAAGCCTTTTTTTTATCCACTACAACCGCACCTGTCACATGCCATGAACAAGCCTGGAACTCATTGCTACTCTAAAAGCACATTTCCACAAATGCTTGAGTATAAACATAGGTGGACCCTGTGGAGATGAATTTTTAAATGCAAACATTTTTCACTAAAACAGTAGTTCCTGCATTAGCCAAAATA

Function


NR:

description
PREDICTED: probable tRNA N6-adenosine threonylcarbamoyltransferase, mitochondrial isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU299220 True 383 lncRNA 0.41 1 45222054 45222436

Neighbor


gene id symbol gene type direction distance location
LOC110520013 LOC106586136 coding downstream 9371 45210945 ~ 45212683 (-)
LOC118956634 NA coding downstream 21392 45197003 ~ 45200662 (-)
LOC110504133 NA coding downstream 31934 45179364 ~ 45190120 (-)
LOC110520012 cssa21h2orf88 coding downstream 117768 45099333 ~ 45104286 (-)
LOC110520009 LOC106586132 coding downstream 235800 44964412 ~ 44986254 (-)
LOC110520016 asnsd1 coding upstream 5814 45228250 ~ 45235027 (-)
si:ch211-136m16.8 LOC106586138 coding upstream 14064 45236500 ~ 45243387 (-)
LOC110520019 LOC106586141 coding upstream 79969 45302405 ~ 45327280 (-)
LOC110520020 LOC106586142 coding upstream 177849 45400285 ~ 45432858 (-)
LOC110520023 LOC106586145 coding upstream 212520 45434956 ~ 45462768 (-)
G263109 NA non-coding downstream 7830 45213745 ~ 45214224 (-)
G263110 NA non-coding downstream 22470 45199219 ~ 45199584 (-)
G263039 NA non-coding downstream 143217 45078521 ~ 45078837 (-)
G263012 NA non-coding downstream 181515 45040218 ~ 45040539 (-)
G263119 NA non-coding upstream 1636 45224072 ~ 45224612 (-)
G263127 NA non-coding upstream 22314 45244750 ~ 45248820 (-)
G263133 NA non-coding upstream 33277 45255713 ~ 45260199 (-)
G263122 NA non-coding upstream 72303 45294739 ~ 45296453 (-)
G262993 NA other downstream 209805 45010172 ~ 45012249 (-)
G261580 NA other downstream 1190549 43989524 ~ 44031505 (-)
G259579 LOC106586070 other downstream 2902669 42290259 ~ 42319385 (-)
G263274 NA other upstream 313896 45536332 ~ 45537542 (-)
G265988 NA other upstream 2376782 47599218 ~ 47599815 (-)
LOC110505248 gcg other upstream 2809611 48032036 ~ 48033434 (-)
G268310 NA other upstream 4273041 49495477 ~ 49495803 (-)
LOC118944672 NA other upstream 4279980 49494001 ~ 49503025 (-)

Expression


G263120 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G263120 Expression in each Bioproject

Bar chart with 14 bars.
G263120 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network