G264758



Basic Information


Item Value
gene id G264758
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 46662339 ~ 46662639 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU300948
gtgcagacctgaccctcttccaggtgcgctcgcaacgttggacaaaagcctgagcggaggggacgctggactcggcgaactgagatgagaacagcggaggctggtacccgaggctactctgaaaaggagatagcccggtcgcagacgaaggaagcgagttgtgggcgtattctgttctgaccaagacgcagggttgcgaaaagaaagactgcgtaagatgcgaccaatagtctgattggcccgttctgcttgaccgttagactgggggtgaaagccggaagagagactgacggaagcccca

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU300948 True 301 lncRNA 0.57 1 46662339 46662639

Neighbor


gene id symbol gene type direction distance location
LOC110520042 LOC106586165 coding downstream 63259 46546837 ~ 46599080 (-)
LOC110504150 LOC106586158 coding downstream 327131 46078061 ~ 46335208 (-)
LOC110520037 pyr5 coding downstream 614480 46043940 ~ 46047859 (-)
LOC110520036 LOC106586156 coding downstream 627912 46031482 ~ 46034427 (-)
LOC110520035 LOC106586155 coding downstream 637932 46020970 ~ 46024407 (-)
rprma rprm coding upstream 56044 46718683 ~ 46721823 (-)
LOC110520047 LOC106586168 coding upstream 339168 47001807 ~ 47007117 (-)
LOC110520049 LOC106586170 coding upstream 475727 47138366 ~ 47145477 (-)
LOC110520051 LOC106586171 coding upstream 485705 47148341 ~ 47177648 (-)
LOC110520052 LOC106586172 coding upstream 525843 47188482 ~ 47228663 (-)
G264714 NA non-coding downstream 107640 46544333 ~ 46554699 (-)
G264657 LOC106586160 non-coding downstream 224774 46434462 ~ 46437565 (-)
G264583 NA non-coding downstream 332349 46329741 ~ 46329990 (-)
G264582 NA non-coding downstream 332894 46329202 ~ 46329445 (-)
G264576 NA non-coding downstream 340038 46322102 ~ 46322301 (-)
G264763 NA non-coding upstream 8747 46671386 ~ 46671623 (-)
G264793 NA non-coding upstream 90595 46753234 ~ 46753710 (-)
G264883 NA non-coding upstream 170472 46833111 ~ 46833339 (-)
G264935 NA non-coding upstream 253189 46915828 ~ 46916800 (-)
G264988 NA non-coding upstream 297723 46960362 ~ 46960564 (-)
G263274 NA other downstream 1124797 45536332 ~ 45537542 (-)
LOC110520012 cssa21h2orf88 other downstream 1558076 45099333 ~ 45104286 (-)
G262993 NA other downstream 1650090 45010172 ~ 45012249 (-)
G261580 NA other downstream 2630834 43989524 ~ 44031505 (-)
col6a3 LOC106598405 other downstream 4346981 42291728 ~ 42329627 (-)
G265988 NA other upstream 936579 47599218 ~ 47599815 (-)
LOC110505248 gcg other upstream 1369408 48032036 ~ 48033434 (-)
G268310 NA other upstream 2832838 49495477 ~ 49495803 (-)
LOC118944672 NA other upstream 2839777 49494001 ~ 49503025 (-)
LOC110520112 LOC106586230 other upstream 2901209 49563841 ~ 49608114 (-)

Expression


G264758 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G264758 Expression in each Bioproject

Bar chart with 10 bars.
G264758 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network