G264259



Basic Information


Item Value
gene id G264259
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 46916418 ~ 46917336 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU300423
GTCCTTAGACCTATACAGAGTACACAGTCAGTCCCTAGACCGATACAGGGTACACAGTCAGTCCCTAGACCTATACAGGGTAAACAGTCAGTCCTTAGTCATATACAGGGTAAACAGTCAGTCCCTAGACCTATACAGGGTAAACAGTCAGTCCTTAGTCCTTTACAGGGTAAACAGTCAGTCCCTAGACCTATACAGTGTAAACAGTCAGTCCTTAGTCCTTTACAGGGTAAACAGTCAGTCCCTATACCCATGCAGGGTAAACAGTCAGTCCTTAGTCCTTTACAGGGTAAACAGTCAGTCCTTAGCCCTGTACATTGTAAACAGTCAGTCCTTAGCCCTATACAGGTTAAACAGTCAGTCCTACCTAACCTATACAGGGTAAACAGTCAGTCCTTAGAAGTATACATTGTACACAGTCTGTCCTTAGACCCATACATTGTAAACAGTCGGTCCTTAGACCTATACAGGGTACACAGTCAGTCCCTAGACCGATACAGGATACACAGTCAGTCCCTAGACCTATAC

Function


NR:

description
rapamycin-insensitive companion of mTOR

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU300423 True 528 lncRNA 0.45 2 46916418 46917336

Neighbor


gene id symbol gene type direction distance location
LOC110520046 LOC106586167 coding upstream 84130 46801058 ~ 46832288 (+)
LOC110520045 LOC106586166 coding upstream 139026 46724055 ~ 46777392 (+)
LOC110504152 LOC106586162 coding upstream 372123 46458590 ~ 46544295 (+)
LOC110520040 LOC106586160 coding upstream 474617 46341848 ~ 46441801 (+)
LOC118957146 NA coding upstream 872573 46032765 ~ 46043845 (+)
LOC110504153 gpd2 coding downstream 103659 47020995 ~ 47027946 (+)
LOC110520048 LOC106586169 coding downstream 201392 47118728 ~ 47133302 (+)
LOC110520055 cg057 coding downstream 328158 47245494 ~ 47255098 (+)
LOC110520054 LOC106586173 coding downstream 338828 47256164 ~ 47259319 (+)
LOC110520056 LOC106586174 coding downstream 397881 47315217 ~ 47441923 (+)
G264255 NA non-coding upstream 5759 46910390 ~ 46910659 (+)
G264230 NA non-coding upstream 49359 46866837 ~ 46867059 (+)
G264229 NA non-coding upstream 50858 46865344 ~ 46865560 (+)
G264067 NA non-coding upstream 299012 46576728 ~ 46617406 (+)
G263962 NA non-coding upstream 578642 46337038 ~ 46337776 (+)
G264985 NA non-coding downstream 42330 46959666 ~ 46960010 (+)
G265131 LOC106586170 non-coding downstream 226234 47143570 ~ 47144441 (+)
G265135 NA non-coding downstream 227812 47145148 ~ 47145451 (+)
G265137 NA non-coding downstream 228601 47145937 ~ 47146332 (+)
G265140 LOC106586171 non-coding downstream 242206 47159542 ~ 47159776 (+)
G263859 LOC107588258 other upstream 731614 46184134 ~ 46184804 (+)
G263733 LOC106586158 other upstream 836993 46075484 ~ 46079425 (+)
G263710 NA other upstream 982000 45934119 ~ 45934418 (+)
G263547 LOC106586150 other upstream 1076938 45838921 ~ 45839480 (+)
G267358 NA other downstream 2593467 49510803 ~ 49512475 (+)
G267381 NA other downstream 2637162 49554498 ~ 49555838 (+)
G267529 NA other downstream 2919281 49836617 ~ 49855502 (+)
hoxd3a hoxd3 other downstream 3244965 50162278 ~ 50184327 (+)
LOC110520146 ino80d other downstream 3684966 50601983 ~ 50618761 (+)

Expression



Co-expression Network