G264998



Basic Information


Item Value
gene id G264998
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 46966733 ~ 46966937 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU301212
atattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaacttcttcacaacagtatctcagacctgcctggtgtgttccttgttcttcatgatgctctttgcgcttcatcattagtcatttaggtcaacattggatcattcagagatcctcactaaacttctggagag

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU301212 True 205 lncRNA 0.41 1 46966733 46966937

Neighbor


gene id symbol gene type direction distance location
rprma rprm coding downstream 244910 46718683 ~ 46721823 (-)
LOC110520042 LOC106586165 coding downstream 367653 46546837 ~ 46599080 (-)
LOC110504150 LOC106586158 coding downstream 631525 46078061 ~ 46335208 (-)
LOC110520037 pyr5 coding downstream 918874 46043940 ~ 46047859 (-)
LOC110520036 LOC106586156 coding downstream 932306 46031482 ~ 46034427 (-)
LOC110520047 LOC106586168 coding upstream 34870 47001807 ~ 47007117 (-)
LOC110520049 LOC106586170 coding upstream 171429 47138366 ~ 47145477 (-)
LOC110520051 LOC106586171 coding upstream 181407 47148341 ~ 47177648 (-)
LOC110520052 LOC106586172 coding upstream 221545 47188482 ~ 47228663 (-)
LOC110520059 LOC106586177 coding upstream 758337 47725274 ~ 47748055 (-)
G264992 NA non-coding downstream 3803 46962660 ~ 46962930 (-)
G264990 NA non-coding downstream 5088 46961337 ~ 46961645 (-)
G264988 NA non-coding downstream 6169 46960362 ~ 46960564 (-)
G264935 NA non-coding downstream 49933 46915828 ~ 46916800 (-)
G264883 NA non-coding downstream 133394 46833111 ~ 46833339 (-)
G265380 NA non-coding upstream 169021 47135958 ~ 47136186 (-)
G265381 NA non-coding upstream 169670 47136607 ~ 47136822 (-)
G265382 NA non-coding upstream 170498 47137435 ~ 47137700 (-)
G265391 NA non-coding upstream 193121 47160058 ~ 47160345 (-)
G263274 NA other downstream 1429191 45536332 ~ 45537542 (-)
LOC110520012 cssa21h2orf88 other downstream 1862470 45099333 ~ 45104286 (-)
G262993 NA other downstream 1954484 45010172 ~ 45012249 (-)
G261580 NA other downstream 2935228 43989524 ~ 44031505 (-)
col6a3 LOC106598405 other downstream 4651375 42291728 ~ 42329627 (-)
G265988 NA other upstream 632281 47599218 ~ 47599815 (-)
LOC110505248 gcg other upstream 1065110 48032036 ~ 48033434 (-)
G268310 NA other upstream 2528540 49495477 ~ 49495803 (-)
LOC118944672 NA other upstream 2535479 49494001 ~ 49503025 (-)
LOC110520112 LOC106586230 other upstream 2596911 49563841 ~ 49608114 (-)

Expression


G264998 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G264998 Expression in each Bioproject

Bar chart with 6 bars.
G264998 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 70.
End of interactive chart.

Co-expression Network