G275196



Basic Information


Item Value
gene id G275196
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 55313011 ~ 55313235 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU312441
TTCCTATCCCCTGACACCACTGAGACCTAACGTTCTCACCAACCAATAACGTCCCTGTTGTATCTCCAGGGACTCACCTCCTATGAGCATGGTGCAGATGGAGAAGATCTTCTCAGAGTCGGTGTTGGCTGAGACGTTTCCGAAGCCCACGCTGGTCAGACTGCTCAGAGCGAAGTACAGAGACGTCACGTAGGAGCTCCTCACTGATGGACCCCCACCCAGAAT

Function


NR:

description
PREDICTED: potassium voltage-gated channel subfamily H member 3-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU312441 True 225 lncRNA 0.54 1 55313011 55313235

Neighbor


gene id symbol gene type direction distance location
idh1 LOC106586335 coding downstream 166623 55131394 ~ 55146388 (-)
LOC110520227 plekhm3 coding downstream 190998 55068639 ~ 55122013 (-)
LOC110520226 LOC106582378 coding downstream 262152 55047518 ~ 55050859 (-)
LOC110520215 LOC106586297 coding downstream 653330 54646623 ~ 54659681 (-)
LOC110520214 LOC106586297 coding downstream 666669 54639230 ~ 54646342 (-)
armc8 armc8 coding upstream 44132 55357367 ~ 55371667 (-)
LOC110520232 LOC106586350 coding upstream 62680 55375915 ~ 55382161 (-)
crygs2 LOC106586348 coding upstream 75866 55389101 ~ 55391332 (-)
LOC110520233 NA coding upstream 78954 55392189 ~ 55395003 (-)
LOC110504309 plcl1 coding upstream 279129 55592364 ~ 55715785 (-)
G275151 NA non-coding downstream 68436 55239719 ~ 55244575 (-)
G275045 NA non-coding downstream 203360 55034597 ~ 55109651 (-)
G275020 NA non-coding downstream 310454 55000183 ~ 55002557 (-)
G274996 NA non-coding downstream 379211 54929696 ~ 54933800 (-)
G275200 NA non-coding upstream 9168 55322403 ~ 55322661 (-)
G275201 NA non-coding upstream 10176 55323411 ~ 55323622 (-)
G275205 NA non-coding upstream 15507 55328742 ~ 55328941 (-)
G275206 LOC106586333 non-coding upstream 16478 55329713 ~ 55329952 (-)
G275211 NA non-coding upstream 20586 55333821 ~ 55334051 (-)
G274344 LOC106586294 other downstream 630206 54679918 ~ 54682805 (-)
G272713 LOC106586324 other downstream 2061927 53249926 ~ 53251084 (-)
LOC110520182 NA other downstream 2604195 52693956 ~ 52708816 (-)
il1rl1 il1rl1 other downstream 3712781 51596933 ~ 51619476 (-)
G275250 NA other upstream 96908 55410143 ~ 55411487 (-)
si:dkey-91i10.3 LOC106586420 other upstream 1957547 57270782 ~ 57297762 (-)
G277673 LOC106586423 other upstream 2089749 57402984 ~ 57403575 (-)
G277749 LOC106586429 other upstream 2271151 57584386 ~ 57589183 (-)
G284018 NA other upstream 7401340 62714575 ~ 62715177 (-)

Expression


G275196 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G275196 Expression in each Bioproject

Bar chart with 6 bars.
G275196 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.

Co-expression Network