G275243



Basic Information


Item Value
gene id G275243
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 55397890 ~ 55398246 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU312490
atgttacacattgtgtttttatattcatatggaatgtgtatttgtttatatgacagagtactagggccacactgaagaaaaaggataaagtcataaatttatgaggctggttctttctgcagaaaagctacatattgtttttacagttttgatacttatgacaatgtgatacttaatattctggcacatcagcatgtctttgtttatgaaaccatactgaagtacaatttcacgaaatgccccacatctgtcattttaacaactgtcctcctttaaaacaactggttacaatattatgacttgtttttttcccctctgtggccctaatactctagcattttatatatagccttatag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU312490 True 357 lncRNA 0.33 1 55397890 55398246

Neighbor


gene id symbol gene type direction distance location
LOC110520233 NA coding downstream 2887 55392189 ~ 55395003 (-)
crygs2 LOC106586348 coding downstream 6558 55389101 ~ 55391332 (-)
LOC110520232 LOC106586350 coding downstream 15729 55375915 ~ 55382161 (-)
armc8 armc8 coding downstream 26223 55357367 ~ 55371667 (-)
idh1 LOC106586335 coding downstream 251502 55131394 ~ 55146388 (-)
LOC110504309 plcl1 coding upstream 194118 55592364 ~ 55715785 (-)
LOC110520238 LOC106586370 coding upstream 381257 55779503 ~ 55821242 (-)
LOC110520241 LOC106586374 coding upstream 492136 55890382 ~ 55923883 (-)
LOC110520251 LOC106586357 coding upstream 585627 55983873 ~ 55985477 (-)
LOC110520250 LOC106586358 coding upstream 588857 55987103 ~ 55988048 (-)
G275234 NA non-coding downstream 10666 55386974 ~ 55387224 (-)
G275229 NA non-coding downstream 22371 55375100 ~ 55375519 (-)
G275183 NA non-coding downstream 41459 55355925 ~ 55356431 (-)
G275244 NA non-coding upstream 1557 55399803 ~ 55400473 (-)
G275248 NA non-coding upstream 6230 55404476 ~ 55404714 (-)
G275249 NA non-coding upstream 7259 55405505 ~ 55405705 (-)
G275250 NA non-coding upstream 11897 55410143 ~ 55411487 (-)
G275252 NA non-coding upstream 14551 55412797 ~ 55413164 (-)
LOC110520227 plekhm3 other downstream 278678 55068639 ~ 55122013 (-)
G274344 LOC106586294 other downstream 715085 54679918 ~ 54682805 (-)
G272713 LOC106586324 other downstream 2146806 53249926 ~ 53251084 (-)
LOC110520182 NA other downstream 2689074 52693956 ~ 52708816 (-)
il1rl1 il1rl1 other downstream 3797660 51596933 ~ 51619476 (-)
si:dkey-91i10.3 LOC106586420 other upstream 1872536 57270782 ~ 57297762 (-)
G277673 LOC106586423 other upstream 2004738 57402984 ~ 57403575 (-)
G277749 LOC106586429 other upstream 2186140 57584386 ~ 57589183 (-)
G284018 NA other upstream 7316329 62714575 ~ 62715177 (-)

Expression


G275243 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G275243 Expression in each Bioproject

Bar chart with 18 bars.
G275243 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network