G275244



Basic Information


Item Value
gene id G275244
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 55399803 ~ 55400473 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU312491
ggacaccacatcctgccaaattccagctgcgctaattgtattgtgttcacagagctcacaagctatcagaaagttgtatggcaaccacctccggtgccaaatagaactggcagacatagacattcagtacaagaagaaaaagatggaaaatcttgcactggagttcgaaataaaaaagaggacaattaggaaactggaccttgaaataaaaaaacttgagagggaggtgagatatgccttcaatgtacactgtatgctaactgtaacacaaatgtattaatcattatttttctttcctcccccagctccaagaagatgacacagctcaaaataaaaattaggtatattctcgtaaagtcaagtgagccatgacatgagctcttattgtgagcacacaggacggtggcatctttctaaggttttttttattttcccagcaatcagtacaaccaagtcatcgttataaggcatcgccctcttttgcccacccccccccagcaccaggtgtggccactagcctatatgaaggcccaaaattgtgtgttcctttctgctctgacaatggcatgcccattcgtgcgagatgtggtggatgaagaagcacttgtgctgaggagagccttcaggtgagaaagggtcttcagggaccggttggacccactggccttccc

Function


NR:

description
uncharacterized protein LOC110534718 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU312491 True 671 lncRNA 0.45 1 55399803 55400473

Neighbor


gene id symbol gene type direction distance location
LOC110520233 NA coding downstream 4800 55392189 ~ 55395003 (-)
crygs2 LOC106586348 coding downstream 8471 55389101 ~ 55391332 (-)
LOC110520232 LOC106586350 coding downstream 17642 55375915 ~ 55382161 (-)
armc8 armc8 coding downstream 28136 55357367 ~ 55371667 (-)
idh1 LOC106586335 coding downstream 253415 55131394 ~ 55146388 (-)
LOC110504309 plcl1 coding upstream 191891 55592364 ~ 55715785 (-)
LOC110520238 LOC106586370 coding upstream 379030 55779503 ~ 55821242 (-)
LOC110520241 LOC106586374 coding upstream 489909 55890382 ~ 55923883 (-)
LOC110520251 LOC106586357 coding upstream 583400 55983873 ~ 55985477 (-)
LOC110520250 LOC106586358 coding upstream 586630 55987103 ~ 55988048 (-)
G275243 NA non-coding downstream 1557 55397890 ~ 55398246 (-)
G275234 NA non-coding downstream 12579 55386974 ~ 55387224 (-)
G275229 NA non-coding downstream 24284 55375100 ~ 55375519 (-)
G275248 NA non-coding upstream 4003 55404476 ~ 55404714 (-)
G275249 NA non-coding upstream 5032 55405505 ~ 55405705 (-)
G275250 NA non-coding upstream 9670 55410143 ~ 55411487 (-)
G275252 NA non-coding upstream 12324 55412797 ~ 55413164 (-)
G275253 NA non-coding upstream 12746 55413219 ~ 55413719 (-)
LOC110520227 plekhm3 other downstream 280591 55068639 ~ 55122013 (-)
G274344 LOC106586294 other downstream 716998 54679918 ~ 54682805 (-)
G272713 LOC106586324 other downstream 2148719 53249926 ~ 53251084 (-)
LOC110520182 NA other downstream 2690987 52693956 ~ 52708816 (-)
il1rl1 il1rl1 other downstream 3799573 51596933 ~ 51619476 (-)
si:dkey-91i10.3 LOC106586420 other upstream 1870309 57270782 ~ 57297762 (-)
G277673 LOC106586423 other upstream 2002511 57402984 ~ 57403575 (-)
G277749 LOC106586429 other upstream 2183913 57584386 ~ 57589183 (-)
G284018 NA other upstream 7314102 62714575 ~ 62715177 (-)

Expression


G275244 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G275244 Expression in each Bioproject

Bar chart with 19 bars.
G275244 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network