G275252



Basic Information


Item Value
gene id G275252
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 55412797 ~ 55413164 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU312502
CAGAGGGGTAGTTCACCATTCCAAAATCAATGTTTGTCAATCCACATTCCTAAATGAATAGGAAAGGTGGTAACTATCTAAAACAATGAACATAGACAGTGTCATTCATCTGGGTTTCAGGCTTATATATGTATGTAGCTATATCTATTGTGGGACTCACCAATAGACTACCTGAAACTTTGAGGTTTGCAAAATGTGATGTTGGAGTGAATTATCACTTTAATTCCAGTAACAATAGGTGAAGATGCATAACCTCTGTTGGGGATCTTCCTATGCAGCCAGAGCCATATTAAATACATGGCTCTGTACGTAGCATGAGAGGTAAAACACAGAGCCTTTATACACCCTAATCACCAACCACCCCTGCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU312502 True 368 lncRNA 0.39 1 55412797 55413164

Neighbor


gene id symbol gene type direction distance location
LOC110520233 NA coding downstream 17794 55392189 ~ 55395003 (-)
crygs2 LOC106586348 coding downstream 21465 55389101 ~ 55391332 (-)
LOC110520232 LOC106586350 coding downstream 30636 55375915 ~ 55382161 (-)
armc8 armc8 coding downstream 41130 55357367 ~ 55371667 (-)
idh1 LOC106586335 coding downstream 266409 55131394 ~ 55146388 (-)
LOC110504309 plcl1 coding upstream 179200 55592364 ~ 55715785 (-)
LOC110520238 LOC106586370 coding upstream 366339 55779503 ~ 55821242 (-)
LOC110520241 LOC106586374 coding upstream 477218 55890382 ~ 55923883 (-)
LOC110520251 LOC106586357 coding upstream 570709 55983873 ~ 55985477 (-)
LOC110520250 LOC106586358 coding upstream 573939 55987103 ~ 55988048 (-)
G275250 NA non-coding downstream 1310 55410143 ~ 55411487 (-)
G275249 NA non-coding downstream 7092 55405505 ~ 55405705 (-)
G275248 NA non-coding downstream 8083 55404476 ~ 55404714 (-)
G275244 NA non-coding downstream 12324 55399803 ~ 55400473 (-)
G275243 NA non-coding downstream 14551 55397890 ~ 55398246 (-)
G275253 NA non-coding upstream 55 55413219 ~ 55413719 (-)
G275255 NA non-coding upstream 2309 55415473 ~ 55444161 (-)
G275273 NA non-coding upstream 31944 55445108 ~ 55446072 (-)
G275274 NA non-coding upstream 33765 55446929 ~ 55447731 (-)
G275275 LOC106586344 non-coding upstream 36876 55450040 ~ 55450325 (-)
LOC110520227 plekhm3 other downstream 293585 55068639 ~ 55122013 (-)
G274344 LOC106586294 other downstream 729992 54679918 ~ 54682805 (-)
G272713 LOC106586324 other downstream 2161713 53249926 ~ 53251084 (-)
LOC110520182 NA other downstream 2703981 52693956 ~ 52708816 (-)
si:dkey-91i10.3 LOC106586420 other upstream 1857618 57270782 ~ 57297762 (-)
G277673 LOC106586423 other upstream 1989820 57402984 ~ 57403575 (-)
G277749 LOC106586429 other upstream 2171222 57584386 ~ 57589183 (-)
G284018 NA other upstream 7301411 62714575 ~ 62715177 (-)
G286522 NA other upstream 9556385 64969549 ~ 64970755 (-)

Expression


G275252 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G275252 Expression in each Bioproject

Bar chart with 12 bars.
G275252 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.

Co-expression Network