G277666



Basic Information


Item Value
gene id G277666
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 57390935 ~ 57391169 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU315181
cttactgacaagcccttaaccaacaatgcagtttaaaaaatacgaataagaaataaaaggaacaagtaattaaagagcaacagtaaaataacaatagtgagactatatacaagtggtaccggtacagagtcaatgtgcgggggcaccagttagtcaaggtaattgaggtaatacgtacatgtaggtagagttattaaagtgactatgcatagataataacagagagtagcagcgg

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU315181 True 235 lncRNA 0.37 1 57390935 57391169

Neighbor


gene id symbol gene type direction distance location
LOC118963713 NA coding downstream 54637 57332568 ~ 57336298 (-)
LOC110520278 LOC106586422 coding downstream 60539 57321238 ~ 57330396 (-)
si:dkey-91i10.3 LOC106586420 coding downstream 99408 57270782 ~ 57297762 (-)
LOC110520276 LOC106586419 coding downstream 130696 57232633 ~ 57260239 (-)
slc49a4 dirc2 coding downstream 183977 57143435 ~ 57206958 (-)
LOC110505369 LOC106586424 coding upstream 18812 57409981 ~ 57414314 (-)
LOC110520281 LOC106586425 coding upstream 24913 57416082 ~ 57427344 (-)
LOC118964377 NA coding upstream 90427 57481596 ~ 57481720 (-)
LOC110520284 LOC106586429 coding upstream 207377 57595333 ~ 57609026 (-)
LOC110520285 LOC106586430 coding upstream 240971 57632140 ~ 57734917 (-)
G277662 LOC106586423 non-coding downstream 8174 57380911 ~ 57382761 (-)
G277661 NA non-coding downstream 11644 57379067 ~ 57379291 (-)
G277660 NA non-coding downstream 15843 57374848 ~ 57375092 (-)
G277656 NA non-coding downstream 23980 57366746 ~ 57366955 (-)
G277653 NA non-coding downstream 31408 57359148 ~ 57359527 (-)
G277671 NA non-coding upstream 5816 57396985 ~ 57397377 (-)
G277675 NA non-coding upstream 9730 57400899 ~ 57401109 (-)
G277676 NA non-coding upstream 13059 57404228 ~ 57404457 (-)
G277642 NA non-coding upstream 45537 57436706 ~ 57436977 (-)
G277692 NA non-coding upstream 56567 57447736 ~ 57448421 (-)
G275250 NA other downstream 1979448 55410143 ~ 55411487 (-)
LOC110520227 plekhm3 other downstream 2271723 55068639 ~ 55122013 (-)
G274344 LOC106586294 other downstream 2708130 54679918 ~ 54682805 (-)
G272713 LOC106586324 other downstream 4139851 53249926 ~ 53251084 (-)
G277673 LOC106586423 other upstream 11815 57402984 ~ 57403575 (-)
G277749 LOC106586429 other upstream 193217 57584386 ~ 57589183 (-)
G284018 NA other upstream 5323406 62714575 ~ 62715177 (-)
G286522 NA other upstream 7578380 64969549 ~ 64970755 (-)
G286580 marco other upstream 7623090 65014259 ~ 65029736 (-)

Expression


G277666 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G277666 Expression in each Bioproject

Bar chart with 19 bars.
G277666 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network