G284018



Basic Information


Item Value
gene id G284018
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 62714575 ~ 62715177 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU322065
GTTGAGGGGAAAAGCACAAGGTTAGTGAGAGATTCGAGAGACATCTCTCTCTTTATGATAAGAGGCACAAAATAACAATATATTACAGTCTTTACAAGACAAATAATTTACACAAAATTAAAACATGATGGTATCAGCTTTTATATGGATATTACACATGTGTGATCTGACACTGGAGCCATACACACATCTATGCTACTGTATACAAAAATCTTCAAATCTTCAAATCTTCAAAGACTTGGTAAATGTTGTTTTTATTTGACAGATCTTGGGATGTATGTAGCCTACAGCCTAATGGCTGGAAGAGTAGTCGAGTCTGCAGACACAGAGGGCTGCAGACACAGAGAGCTGCAGACACAGAGAGCTGCAGGCACAGAGAGCTGCAGACACAGAGCTCTGCAGACAGAGCTCTGCAGACACAGAGCGCTGCAGACACAGAGAGCTGCAGACACAGAGAGCTGCAGACACAGAGCGCTGCAGACACAGAGCTCTGCAGACACAGAGCTCTGCAGACAGAGCTCTGCAGACACAGAGCGCTGCAGACACAGAGAGCTGCAGACATCGAGAGCTGCAGACACAGAGAGCTGCAGACACAGAGCGCTG

Function


NR:

description
serine/arginine repetitive matrix protein 2-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU322065 True 603 TUCP 0.46 1 62714575 62715177
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110520350 LOC106586501 coding downstream 118876 62547867 ~ 62595699 (-)
trnal-caa-2 NA coding downstream 171246 62543221 ~ 62543329 (-)
trnal-caa NA coding downstream 171877 62542589 ~ 62542698 (-)
LOC110520347 lrch1 coding downstream 181268 62425684 ~ 62533307 (-)
LOC110520342 itm2b coding downstream 465074 62231915 ~ 62249501 (-)
LOC110520353 LOC106586507 coding upstream 33247 62748424 ~ 62780312 (-)
LOC110520357 asmt coding upstream 117731 62832908 ~ 62841097 (-)
LOC110520356 LOC106586509 coding upstream 126283 62841460 ~ 62853914 (-)
LOC110520358 LOC106586406 coding upstream 140702 62855879 ~ 62858995 (-)
LOC110504409 sh3rf3 coding upstream 154571 62869748 ~ 62943518 (-)
G284012 LOC106586506 non-coding downstream 10473 62703779 ~ 62704102 (-)
G283998 NA non-coding downstream 44175 62670174 ~ 62670400 (-)
G283992 NA non-coding downstream 58809 62655557 ~ 62655766 (-)
G283991 NA non-coding downstream 59698 62653440 ~ 62654877 (-)
G283990 NA non-coding downstream 61466 62652678 ~ 62653109 (-)
G284023 NA non-coding upstream 9844 62725021 ~ 62726045 (-)
G284040 NA non-coding upstream 27344 62742521 ~ 62742930 (-)
G284162 NA non-coding upstream 119317 62834494 ~ 62836044 (-)
G284213 NA non-coding upstream 139406 62854583 ~ 62854787 (-)
G284217 NA non-coding upstream 147576 62862753 ~ 62864090 (-)
G277749 LOC106586429 other downstream 5125392 57584386 ~ 57589183 (-)
G277673 LOC106586423 other downstream 5311000 57402984 ~ 57403575 (-)
si:dkey-91i10.3 LOC106586420 other downstream 5416813 57270782 ~ 57297762 (-)
G275250 NA other downstream 7303088 55410143 ~ 55411487 (-)
LOC110520227 plekhm3 other downstream 7595363 55068639 ~ 55122013 (-)
G286522 NA other upstream 2254372 64969549 ~ 64970755 (-)
G286580 marco other upstream 2299082 65014259 ~ 65029736 (-)
G286638 NA other upstream 2339523 65054700 ~ 65075985 (-)
G286953 LOC107579696 other upstream 2520003 65235180 ~ 65235908 (-)
G286985 LOC106586592 other upstream 2583030 65298207 ~ 65300417 (-)

Expression


G284018 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G284018 Expression in each Bioproject

Bar chart with 9 bars.
G284018 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network