G283867



Basic Information


Item Value
gene id G283867
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 62722295 ~ 62722740 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU321903
ggcacatgcctgtctatataaggccccacagttgacactgcatgtcagagcaaaaaccaagccatgaggtccaaagaattgtccgtagagctccgagacaagattgtgtcgaggcacagatctgggtatgggtaccaaaaaatgtgtgcatcattgaaggtccccaagaacacagtggcctccatcattcttacatggaagaagtttggaaccaccaagactcttcctagagctggccgcccggccaaactgagcaatcagggagaagggccttggtcagggagaacccaatggtcactctgacagagctctagagttcctctgtggagatgggagaaccttccagaaggacaaccatctctgcagcactccatcaatcagccctttatgatagagtggccagacggaagccactcctcagtaaaaggtacctaaaggactcagac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU321903 True 446 lncRNA 0.51 1 62722295 62722740
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504398 LOC106586506 coding upstream 9555 62705451 ~ 62712740 (+)
LOC118964306 LOC106586506 coding upstream 21082 62698887 ~ 62701213 (+)
LOC110520352 LOC106586504 coding upstream 73780 62622919 ~ 62648515 (+)
LOC110504388 LOC106586502 coding upstream 109820 62598677 ~ 62612475 (+)
dhrs12 LOC106586499 coding upstream 174513 62543577 ~ 62547782 (+)
LOC110520355 LOC105016359 coding downstream 60506 62770924 ~ 62815230 (+)
LOC118964307 NA coding downstream 135473 62858213 ~ 62860498 (+)
LOC110520359 LOC106586511 coding downstream 224578 62947318 ~ 63007919 (+)
LOC110520363 NA coding downstream 390927 63113667 ~ 63119407 (+)
LOC110520364 LOC106586514 coding downstream 401640 63124380 ~ 63129015 (+)
G283859 NA non-coding upstream 7112 62714856 ~ 62715183 (+)
G283860 NA non-coding upstream 8447 62713143 ~ 62713848 (+)
G283840 NA non-coding upstream 51807 62670211 ~ 62670488 (+)
G283836 NA non-coding upstream 58586 62663380 ~ 62663709 (+)
G283833 NA non-coding upstream 67141 62654930 ~ 62655154 (+)
G284045 NA non-coding downstream 25688 62748428 ~ 62750633 (+)
G284057 NA non-coding downstream 41181 62763921 ~ 62768887 (+)
G284091 NA non-coding downstream 101469 62824209 ~ 62824528 (+)
G284093 NA non-coding downstream 106945 62829685 ~ 62830227 (+)
LOC110520346 htr2a other upstream 313438 62367489 ~ 62408857 (+)
LOC110520339 lrrc63 other upstream 525344 62193287 ~ 62200069 (+)
G282707 il-1rii other upstream 760820 61957388 ~ 61964066 (+)
G281996 NA other upstream 1685190 61033766 ~ 61037105 (+)
G284313 NA other downstream 293586 63016326 ~ 63022591 (+)
G284537 NA other downstream 544379 63267119 ~ 63312394 (+)
G284599 NA other downstream 668191 63390931 ~ 63391284 (+)
G284986 LOC106586530 other downstream 983828 63706568 ~ 63722064 (+)

Expression


G283867 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G283867 Expression in each Bioproject

Bar chart with 19 bars.
G283867 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network