G285713



Basic Information


Item Value
gene id G285713
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 64276604 ~ 64276974 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU323959
gatactgttgtgaagaagtttaaagccggatttggataccaaaagatttcccaagctttaaacatcccaaggagcactgtgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatatacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU323959 True 371 lncRNA 0.43 1 64276604 64276974

Neighbor


gene id symbol gene type direction distance location
LOC110520380 LOC106586540 coding downstream 102328 63911999 ~ 64174276 (-)
LOC110505395 LOC106586542 coding downstream 372386 63901468 ~ 63904218 (-)
LOC110505387 LOC106586543 coding downstream 390103 63881857 ~ 63886501 (-)
LOC110520378 LOC106586545 coding downstream 400866 63867161 ~ 63875738 (-)
LOC110520377 LOC106586531 coding downstream 454009 63780997 ~ 63822595 (-)
LOC110520379 NA coding upstream 208815 64485789 ~ 64641565 (-)
LOC110520388 cssa25h3orf38 coding upstream 575529 64852503 ~ 64855851 (-)
LOC110520386 LOC106586581 coding upstream 585052 64862026 ~ 64890987 (-)
LOC118944694 ccdc93 coding upstream 607364 64884338 ~ 64895983 (-)
en1a en1 coding upstream 710779 64987753 ~ 64995840 (-)
G285696 NA non-coding downstream 10603 64265798 ~ 64266001 (-)
G285692 NA non-coding downstream 11695 64264653 ~ 64264909 (-)
G285683 NA non-coding downstream 15362 64261015 ~ 64261242 (-)
G285678 NA non-coding downstream 21728 64254633 ~ 64254876 (-)
G285629 NA non-coding downstream 62265 64214030 ~ 64214339 (-)
G285719 NA non-coding upstream 2343 64279317 ~ 64279557 (-)
G285720 NA non-coding upstream 2669 64279643 ~ 64279931 (-)
G285733 NA non-coding upstream 12249 64289223 ~ 64289465 (-)
G285740 NA non-coding upstream 15377 64292351 ~ 64292728 (-)
G285758 NA non-coding upstream 26558 64303532 ~ 64303757 (-)
G284018 NA other downstream 1561427 62714575 ~ 62715177 (-)
G277749 LOC106586429 other downstream 6687421 57584386 ~ 57589183 (-)
G277673 LOC106586423 other downstream 6873029 57402984 ~ 57403575 (-)
si:dkey-91i10.3 LOC106586420 other downstream 6978842 57270782 ~ 57297762 (-)
G275250 NA other downstream 8865117 55410143 ~ 55411487 (-)
G286522 NA other upstream 692575 64969549 ~ 64970755 (-)
G286580 marco other upstream 737285 65014259 ~ 65029736 (-)
G286638 NA other upstream 777726 65054700 ~ 65075985 (-)
G286953 LOC107579696 other upstream 958206 65235180 ~ 65235908 (-)
G286985 LOC106586592 other upstream 1021233 65298207 ~ 65300417 (-)

Expression


G285713 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G285713 Expression in each Bioproject

Bar chart with 19 bars.
G285713 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network