G285837



Basic Information


Item Value
gene id G285837
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 64361472 ~ 64361871 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU324085
gcaaaaggcatgagaaggtaggcgaataattacaattatgcagattaacactggagtgataaatgatcagatggttatgtacaggtagagatattggtgtgcaaaagagcagaaaaataaataaataaaaacagtatggggatgaggtaggtgaaaaatgggtgggctatttaccaatagactatgtacagctgcagcgatcggttagctgctcagatagcagatgtttgaagttggtgagggagataaaagtctccaacttcagcgatttttgcaattcattccagtcacaggcagcagagaactggaacgaaaggcggccaaatgaggtgttggctttagggatgatcagtgagatacacctgctggagcgcgtgctacggatgggtgttgccatcgt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU324085 True 400 lncRNA 0.43 1 64361472 64361871

Neighbor


gene id symbol gene type direction distance location
LOC110520380 LOC106586540 coding downstream 187196 63911999 ~ 64174276 (-)
LOC110505395 LOC106586542 coding downstream 457254 63901468 ~ 63904218 (-)
LOC110505387 LOC106586543 coding downstream 474971 63881857 ~ 63886501 (-)
LOC110520378 LOC106586545 coding downstream 485734 63867161 ~ 63875738 (-)
LOC110520377 LOC106586531 coding downstream 538877 63780997 ~ 63822595 (-)
LOC110520379 NA coding upstream 123918 64485789 ~ 64641565 (-)
LOC110520388 cssa25h3orf38 coding upstream 490632 64852503 ~ 64855851 (-)
LOC110520386 LOC106586581 coding upstream 500155 64862026 ~ 64890987 (-)
LOC118944694 ccdc93 coding upstream 522467 64884338 ~ 64895983 (-)
en1a en1 coding upstream 625882 64987753 ~ 64995840 (-)
G285804 NA non-coding downstream 25133 64336138 ~ 64336339 (-)
G285789 NA non-coding downstream 34500 64326652 ~ 64326972 (-)
G285782 NA non-coding downstream 42344 64318915 ~ 64319128 (-)
G285758 NA non-coding downstream 57715 64303532 ~ 64303757 (-)
G285740 NA non-coding downstream 68744 64292351 ~ 64292728 (-)
G285842 NA non-coding upstream 7301 64369172 ~ 64369482 (-)
G285846 NA non-coding upstream 8837 64370708 ~ 64371440 (-)
G285848 NA non-coding upstream 10701 64372572 ~ 64372778 (-)
G285863 LOC107663003 non-coding upstream 21263 64383134 ~ 64383438 (-)
G286066 NA non-coding upstream 71854 64433725 ~ 64434020 (-)
G284018 NA other downstream 1646295 62714575 ~ 62715177 (-)
G277749 LOC106586429 other downstream 6772289 57584386 ~ 57589183 (-)
G277673 LOC106586423 other downstream 6957897 57402984 ~ 57403575 (-)
si:dkey-91i10.3 LOC106586420 other downstream 7063710 57270782 ~ 57297762 (-)
G275250 NA other downstream 8949985 55410143 ~ 55411487 (-)
G286522 NA other upstream 607678 64969549 ~ 64970755 (-)
G286580 marco other upstream 652388 65014259 ~ 65029736 (-)
G286638 NA other upstream 692829 65054700 ~ 65075985 (-)
G286953 LOC107579696 other upstream 873309 65235180 ~ 65235908 (-)
G286985 LOC106586592 other upstream 936336 65298207 ~ 65300417 (-)

Expression


G285837 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G285837 Expression in each Bioproject

Bar chart with 13 bars.
G285837 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network