G286204



Basic Information


Item Value
gene id G286204
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 64692383 ~ 64692728 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU324473
gtgttgcttgcctcgaagcgagcatagaagtgatttaggtcatctggtaggctcgtgtcactgggcagctcgcggctgtgcttccctttgtagtctgtaatagtttgcaagccctgccacataagacgagcgtcggagccggtgtagtatgattcaatcttagccctgtattgacgcattgcctgtttgatggttcgtcgcaaagcattgcaggatttcttgtaagcttccaggttagagtcctgcagcttgaaagcggcagctctaccctttagctcagtgcaaatgttgcctgcaatccatggcttctggttggggtatgtacgtacagtcactgtgggaacaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU324473 True 346 lncRNA 0.50 1 64692383 64692728

Neighbor


gene id symbol gene type direction distance location
LOC110520382 LOC106586539 coding upstream 309592 64380591 ~ 64382791 (+)
LOC110520383 LOC106586541 coding upstream 717907 63972679 ~ 63974476 (+)
LOC110504443 fbxo47 coding upstream 792190 63894665 ~ 63900193 (+)
LOC118944562 LOC106562846 coding upstream 803172 63888258 ~ 63889211 (+)
gtf2f2b LOC105016382 coding upstream 1010141 63625840 ~ 63682242 (+)
zgc:152951 glrx coding downstream 162012 64854740 ~ 64861974 (+)
insig2 LOC104950207 coding downstream 215918 64908646 ~ 64914396 (+)
marco marco coding downstream 321563 65014291 ~ 65029795 (+)
steap3 LOC106586584 coding downstream 440541 65133269 ~ 65146515 (+)
LOC110520396 LOC100136409 coding downstream 468614 65161342 ~ 65166580 (+)
G286195 NA non-coding upstream 3036 64688803 ~ 64689347 (+)
G286192 NA non-coding upstream 5813 64686241 ~ 64686570 (+)
G285995 NA non-coding upstream 72641 64618562 ~ 64619742 (+)
G285977 NA non-coding upstream 110081 64582079 ~ 64582302 (+)
G285969 NA non-coding upstream 140865 64551304 ~ 64551518 (+)
G286229 NA non-coding downstream 18971 64711699 ~ 64712188 (+)
G286240 NA non-coding downstream 30891 64723619 ~ 64724332 (+)
G286282 NA non-coding downstream 70170 64762898 ~ 64763521 (+)
G286284 NA non-coding downstream 70890 64763618 ~ 64763851 (+)
G286291 NA non-coding downstream 76177 64768905 ~ 64769171 (+)
G285763 NA other upstream 385023 64306512 ~ 64307360 (+)
G285203 NA other upstream 608401 64071432 ~ 64083982 (+)
G285001 NA other upstream 946890 63743006 ~ 63745493 (+)
G284986 LOC106586530 other upstream 970319 63706568 ~ 63722064 (+)
G284599 NA other upstream 1301099 63390931 ~ 63391284 (+)
G286679 NA other downstream 416528 65109256 ~ 65109637 (+)
zmym2 LOC106586592 other downstream 567717 65260200 ~ 65311166 (+)
LOC118964312 LOC106586611 other downstream 1341692 66027633 ~ 66036299 (+)
G288252 NA other downstream 1857094 66549822 ~ 66550487 (+)

Expression


G286204 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G286204 Expression in each Bioproject

Bar chart with 20 bars.
G286204 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network