G286631



Basic Information


Item Value
gene id G286631
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 65089552 ~ 65090664 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU324961
gagaccatgctaaacagagagacagatgagaccatgctaaacagagagacagatgaaaccatgctaaacagagagacagatgagaccatgctaaacagagagacagatgagaccatgctaaacagagagatagattagactatgctaaacagagagacagatgagaccatgctaaacagactgacagatgagaccatgctagacagacagatgagaccatgctaaacagaaagacagatgagaccatgctaaacagagagacagatgagaccatgctaaacagaaagacagattagaccatgctaaacagacagacagatgagaccatgctaaacagacagacagatgagaccatgctaaacagacagacagatgagaccatgctaaacagagagacagatgagaccatgctaaacagagagacagatgagaccatgctaaacagagagacagatg

Function


NR:

description
putative uncharacterized protein DDB_G0282133

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU324961 True 456 lncRNA 0.43 2 65089552 65090664
Loading

Neighbor


gene id symbol gene type direction distance location
marco marco coding upstream 59757 65014291 ~ 65029795 (+)
insig2 LOC104950207 coding upstream 175156 64908646 ~ 64914396 (+)
zgc:152951 glrx coding upstream 227578 64854740 ~ 64861974 (+)
LOC110520382 LOC106586539 coding upstream 706761 64380591 ~ 64382791 (+)
LOC110520383 LOC106586541 coding upstream 1115076 63972679 ~ 63974476 (+)
steap3 LOC106586584 coding downstream 42605 65133269 ~ 65146515 (+)
LOC110520396 LOC100136409 coding downstream 70678 65161342 ~ 65166580 (+)
tmem37 tmem37 coding downstream 80965 65170904 ~ 65176413 (+)
LOC110520399 LOC106586589 coding downstream 101393 65192057 ~ 65212814 (+)
LOC118964311 LOC106586591 coding downstream 126393 65217057 ~ 65231345 (+)
G286546 en1 non-coding upstream 97432 64987750 ~ 64992120 (+)
G286535 NA non-coding upstream 109219 64979609 ~ 64980333 (+)
G286532 NA non-coding upstream 112860 64976468 ~ 64976692 (+)
G286508 NA non-coding upstream 128403 64960933 ~ 64961149 (+)
G286398 NA non-coding upstream 158437 64930527 ~ 64931115 (+)
G286677 LOC106586564 non-coding downstream 16122 65106786 ~ 65108183 (+)
G286680 NA non-coding downstream 19117 65109781 ~ 65109981 (+)
G286681 NA non-coding downstream 19529 65110193 ~ 65110400 (+)
G286757 NA non-coding downstream 60049 65150713 ~ 65151016 (+)
G286759 NA non-coding downstream 62657 65153321 ~ 65153691 (+)
G285763 NA other upstream 782192 64306512 ~ 64307360 (+)
G285203 NA other upstream 1005570 64071432 ~ 64083982 (+)
G285001 NA other upstream 1344059 63743006 ~ 63745493 (+)
G284986 LOC106586530 other upstream 1367488 63706568 ~ 63722064 (+)
G284599 NA other upstream 1698268 63390931 ~ 63391284 (+)
G286679 NA other downstream 18592 65109256 ~ 65109637 (+)
zmym2 LOC106586592 other downstream 169781 65260200 ~ 65311166 (+)
LOC118964312 LOC106586611 other downstream 943756 66027633 ~ 66036299 (+)
G288252 NA other downstream 1459158 66549822 ~ 66550487 (+)

Expression


G286631 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G286631 Expression in each Bioproject

Bar chart with 14 bars.
G286631 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network