G286824 (xpo4)


Basic Information

Item Value
gene id G286824
gene name xpo4
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 65407736 ~ 65410917 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU325181
ACACAGGTGTCGAGCAGGGCTTCTCTCCAGGTCTCTGTGGGCTTCAGCATCACGTTCTGGGTGGACTCAAACATGGCGATGTAGTGGCGCCCCAGATTGGGCGGCAAGAAGTTCCAGCTGAGGACCTGATTGGCCAGGGCCAGGTATCTCTGGAACACTGAGGACATCTGAGCGTTGAGGTTCTCTCTGCGACTGAACTCCTGCAGCACCTCCATGGTCAACATGAAGATCTGATGAAGGTCA

Function

symbol description
xpo4 Predicted to enable nuclear export signal receptor activity. Predicted to be involved in protein export from nucleus. Predicted to act upstream of or within protein transport. Predicted to be located in nucleus. Predicted to be part of nuclear pore. Predicted to be active in cytoplasm. Is expressed in several structures, including adaxial cell; alar plate midbrain region; eye; midbrain; and musculature system. Orthologous to human XPO4 (exportin 4).

NR:

description
exportin-4

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU325181 True 243 lncRNA 0.56 2 65407736 65410917

Neighbor

gene id symbol gene type direction distance location
ift88 ift88 coding upstream 21030 65362736 ~ 65386706 (+)
zmym2 LOC106586592 coding upstream 96570 65260200 ~ 65311166 (+)
LOC110520400 NA coding upstream 165089 65241290 ~ 65242647 (+)
LOC118964311 LOC106586591 coding upstream 176391 65217057 ~ 65231345 (+)
LOC110520399 LOC106586589 coding upstream 194922 65192057 ~ 65212814 (+)
LOC110520411 NA coding downstream 78289 65489157 ~ 65491432 (+)
popdc2 popdc2 coding downstream 81042 65491959 ~ 65503791 (+)
wars2 wars2 coding downstream 172118 65583035 ~ 65599863 (+)
LOC110520416 tbx15 coding downstream 203268 65614185 ~ 65637086 (+)
LOC110520417 gdap2 coding downstream 366279 65777196 ~ 65813495 (+)
G286726 LOC106582068 non-coding upstream 12951 65394376 ~ 65394785 (+)
G286790 NA non-coding upstream 73618 65291466 ~ 65334118 (+)
G286791 NA non-coding upstream 105941 65300888 ~ 65301795 (+)
G286777 NA non-coding upstream 156367 65251083 ~ 65251369 (+)
G286775 LOC107756720 non-coding upstream 171996 65234814 ~ 65235740 (+)
G286843 NA non-coding downstream 33395 65444312 ~ 65444554 (+)
G286849 LOC106586596 non-coding downstream 42788 65453705 ~ 65454341 (+)
G286855 NA non-coding downstream 50079 65460996 ~ 65554174 (+)
G286869 LOC106586566 non-coding downstream 70364 65481281 ~ 65482260 (+)
LOC110520396 LOC100136409 other upstream 241156 65161342 ~ 65166580 (+)
G286679 NA other upstream 298099 65109256 ~ 65109637 (+)
G285763 NA other upstream 1100376 64306512 ~ 64307360 (+)
G285203 NA other upstream 1323754 64071432 ~ 64083982 (+)
LOC118964312 LOC106586611 other downstream 623503 66027633 ~ 66036299 (+)
G288252 NA other downstream 1138905 66549822 ~ 66550487 (+)
G288430 NA other downstream 1320369 66731286 ~ 66733797 (+)
LOC110505407 LOC106586622 other downstream 1372456 66783373 ~ 66787442 (+)
G288674 NA other downstream 1582254 66993171 ~ 66994131 (+)

Expression


Co-expression Network