G287697



Basic Information


Item Value
gene id G287697
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 66075183 ~ 66075418 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU326190
atttcagtttgtcagtgatgtgtatgccgaggaacttaaagctttccaccttctccactacagtcccgtcaatgtggacaaggggggtgctccctctgctgtttcctgaagtccatgatcatctcctttattttgttgatgttgagtgaaaggttatttttctggcaccacactcccagagccctcccctcctccctgtaggctgtctcgacattgttggtaatcaagcctactac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU326190 True 236 lncRNA 0.48 1 66075183 66075418
Loading

Neighbor


gene id symbol gene type direction distance location
rnf17 rnf17 coding downstream 5049 66036342 ~ 66070134 (-)
ttf2 ttf2 coding downstream 47582 66020033 ~ 66027601 (-)
LOC110520422 vtcn1 coding downstream 91058 65978825 ~ 65984444 (-)
LOC110520420 trim45 coding downstream 96474 65973480 ~ 65978709 (-)
LOC110520419 man1a2 coding downstream 111470 65853721 ~ 65963713 (-)
LOC110520425 LOC106582038 coding upstream 107698 66183116 ~ 66193487 (-)
LOC110520429 LOC106586615 coding upstream 192767 66268185 ~ 66295887 (-)
LOC118964314 NA coding upstream 324649 66400067 ~ 66412373 (-)
LOC118944607 LOC106582097 coding upstream 396921 66472339 ~ 66475059 (-)
LOC110520431 LOC106586619 coding upstream 415050 66490468 ~ 66537895 (-)
G287693 NA non-coding downstream 5823 66069137 ~ 66069360 (-)
G287666 NA non-coding downstream 74994 65997968 ~ 66000189 (-)
G287664 NA non-coding downstream 77593 65993773 ~ 65997590 (-)
LOC110520418 fam46c non-coding downstream 252593 65821455 ~ 65840478 (-)
G287706 NA non-coding upstream 12887 66088305 ~ 66088557 (-)
G287853 NA non-coding upstream 32454 66107872 ~ 66108434 (-)
G287919 NA non-coding upstream 133743 66209161 ~ 66246589 (-)
G287929 NA non-coding upstream 157289 66232707 ~ 66234021 (-)
G287951 NA non-coding upstream 202962 66278380 ~ 66278703 (-)
G287112 NA other downstream 494688 65579791 ~ 65580495 (-)
G287042 NA other downstream 627900 65446825 ~ 65447283 (-)
G286985 LOC106586592 other downstream 774766 65298207 ~ 65300417 (-)
G286953 LOC107579696 other downstream 839275 65235180 ~ 65235908 (-)
G286638 NA other downstream 999198 65054700 ~ 65075985 (-)
G288578 NA other upstream 767253 66842671 ~ 66842881 (-)
G289678 NA other upstream 1551414 67626832 ~ 67633493 (-)
G289653 LOC106607871 other upstream 1808334 67883752 ~ 67886232 (-)
si:ch211-214p13.7 NA other upstream 2131172 68206330 ~ 68208674 (-)
G290542 NA other upstream 2503685 68579103 ~ 68580707 (-)

Expression


G287697 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G287697 Expression in each Bioproject

Bar chart with 11 bars.
G287697 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network