G290567



Basic Information


Item Value
gene id G290567
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 68626332 ~ 68647620 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU329467
ctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatgactgtctgtttctctctctctctctctacatggctgtctgtttctctatgtctctctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctatgtctctctacatggctgtctgtttctctatgtctctctacatggctgtctgtttctctctgtctctctctacatggctgtctgtttctctctgtctctctacatggctgtatgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatggtagtatgtttctctctgtctctctacatggctgtctgtttctctctgtctctctctacatggctgtctgtttctctctgtctctctacatggctgtatgtttctctctgtcgctctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctacatggctgtctgtttctctctgtctctctacatggctctctgtttctctctgtctctctctacatggatgtctgtttctctctgtctctcgcctcatgactgtctgtttctctctgtctctctacatggctctctgtttctctctgtctctctctacatggatgtctgtttctctctctctctctacatggctgtatgtttctctctgtctctctacatggctgtctgtttctctctgtctgtctacatggctgtctgtttctctctgtctctctacatggctctctgtttctctctgtctctctacatggctgtcattttctctctgtctctctacatggctctctgtttctctctgtctctccctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatggctgtctgtttctctctgtctctctacatggct

Function


NR:

description
PREDICTED: keratin-associated protein 5-5-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU329467 True 1102 TUCP 0.46 2 68626332 68647620
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110520471 NA coding downstream 39590 68584472 ~ 68586742 (-)
LOC110520470 LOC106586656 coding downstream 165753 68455461 ~ 68460579 (-)
LOC110520467 LOC106586653 coding downstream 333582 68278572 ~ 68292750 (-)
LOC110520466 cd200 coding downstream 373091 68227272 ~ 68253241 (-)
si:ch211-214p13.7 NA coding downstream 417658 68206330 ~ 68208674 (-)
LOC110520474 LOC106586664 coding upstream 612883 69260503 ~ 69277276 (-)
LOC110520476 LOC106586666 coding upstream 732847 69380467 ~ 69469698 (-)
LOC110520477 LOC106586672 coding upstream 948217 69595837 ~ 69614655 (-)
LOC110520480 ube2al coding upstream 993646 69641214 ~ 69644739 (-)
ankrd10b LOC106586677 coding upstream 1001917 69649537 ~ 69675010 (-)
G290539 NA non-coding downstream 53023 68573110 ~ 68573309 (-)
G290534 NA non-coding downstream 70230 68555217 ~ 68556102 (-)
G290526 NA non-coding downstream 86535 68539416 ~ 68539797 (-)
G290520 NA non-coding downstream 98144 68527933 ~ 68528188 (-)
G290519 NA non-coding downstream 98823 68527281 ~ 68527509 (-)
G290597 NA non-coding upstream 63393 68711013 ~ 68715853 (-)
G290599 NA non-coding upstream 75279 68722899 ~ 68727546 (-)
G290623 NA non-coding upstream 107790 68755410 ~ 68755852 (-)
G290672 NA non-coding upstream 166866 68814486 ~ 68814889 (-)
G290673 NA non-coding upstream 167392 68815012 ~ 68815236 (-)
G290542 NA other downstream 45625 68579103 ~ 68580707 (-)
G289653 LOC106607871 other downstream 740100 67883752 ~ 67886232 (-)
G289678 NA other downstream 992839 67626832 ~ 67633493 (-)
G288578 NA other downstream 1783451 66842671 ~ 66842881 (-)
G290598 NA other upstream 62747 68710367 ~ 68717385 (-)
G290602 NA other upstream 74188 68721808 ~ 68724914 (-)
G290713 LOC106586659 other upstream 198991 68846611 ~ 68850854 (-)
G291138 NA other upstream 608385 69256005 ~ 69256544 (-)
G291901 LOC106586687 other upstream 1332726 69980346 ~ 69996605 (-)

Expression


G290567 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

G290567 Expression in each Bioproject

Bar chart with 16 bars.
G290567 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network