G290683



Basic Information


Item Value
gene id G290683
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 68820595 ~ 68820870 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU329602
gagatcaccaagcgcaacatagcttcagcgtgtaaatcagctagaaagatgtgtcggcatcgagtaattgtctctggccccctcccagttagggggagtgatgagctctacagcagagtctcacaactcaatcactggttgaaaactgttttctgcccctcccaaaagatggaatttgtagataattggccatctttctgggactcacccacaaacaggaccaagcctgacctgctgaggagtgacggactccatcctaactggaggggtgctctc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU329602 True 276 lncRNA 0.50 1 68820595 68820870
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110520471 NA coding downstream 233853 68584472 ~ 68586742 (-)
LOC110520470 LOC106586656 coding downstream 360016 68455461 ~ 68460579 (-)
LOC110520467 LOC106586653 coding downstream 527845 68278572 ~ 68292750 (-)
LOC110520466 cd200 coding downstream 567354 68227272 ~ 68253241 (-)
si:ch211-214p13.7 NA coding downstream 611921 68206330 ~ 68208674 (-)
LOC110520474 LOC106586664 coding upstream 439633 69260503 ~ 69277276 (-)
LOC110520476 LOC106586666 coding upstream 559597 69380467 ~ 69469698 (-)
LOC110520477 LOC106586672 coding upstream 774967 69595837 ~ 69614655 (-)
LOC110520480 ube2al coding upstream 820396 69641214 ~ 69644739 (-)
ankrd10b LOC106586677 coding upstream 828667 69649537 ~ 69675010 (-)
G290676 NA non-coding downstream 3521 68816037 ~ 68817074 (-)
G290674 NA non-coding downstream 4957 68815330 ~ 68815638 (-)
G290673 NA non-coding downstream 5359 68815012 ~ 68815236 (-)
G290672 NA non-coding downstream 5706 68814486 ~ 68814889 (-)
G290623 NA non-coding downstream 64743 68755410 ~ 68755852 (-)
G290686 NA non-coding upstream 2182 68823052 ~ 68823271 (-)
G290706 NA non-coding upstream 23916 68844786 ~ 68845063 (-)
G290714 NA non-coding upstream 31008 68851878 ~ 68853389 (-)
G290715 NA non-coding upstream 32575 68853445 ~ 68854358 (-)
G290954 NA non-coding upstream 93884 68914754 ~ 68915505 (-)
G290602 NA other downstream 95681 68721808 ~ 68724914 (-)
G290598 NA other downstream 103210 68710367 ~ 68717385 (-)
G290567 NA other downstream 172975 68626332 ~ 68647620 (-)
G290542 NA other downstream 239888 68579103 ~ 68580707 (-)
G290713 LOC106586659 other upstream 25741 68846611 ~ 68850854 (-)
G291138 NA other upstream 435135 69256005 ~ 69256544 (-)
G291901 LOC106586687 other upstream 1159476 69980346 ~ 69996605 (-)
G291977 NA other upstream 1286670 70107540 ~ 70107950 (-)
G292753 NA other upstream 1899166 70720036 ~ 70720591 (-)

Expression


G290683 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G290683 Expression in each Bioproject

Bar chart with 16 bars.
G290683 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network