G291098



Basic Information


Item Value
gene id G291098
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 69174337 ~ 69203968 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU330080
atattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgaaaaaagttaatgtttggcgtaaaagcaacacagctgaacacaccatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU330080 True 382 lncRNA 0.43 2 69174337 69203968
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110520471 NA coding downstream 587595 68584472 ~ 68586742 (-)
LOC110520470 LOC106586656 coding downstream 713758 68455461 ~ 68460579 (-)
LOC110520467 LOC106586653 coding downstream 881587 68278572 ~ 68292750 (-)
LOC110520466 cd200 coding downstream 921096 68227272 ~ 68253241 (-)
si:ch211-214p13.7 NA coding downstream 965663 68206330 ~ 68208674 (-)
LOC110520474 LOC106586664 coding upstream 56535 69260503 ~ 69277276 (-)
LOC110520476 LOC106586666 coding upstream 176499 69380467 ~ 69469698 (-)
LOC110520477 LOC106586672 coding upstream 391869 69595837 ~ 69614655 (-)
LOC110520480 ube2al coding upstream 437298 69641214 ~ 69644739 (-)
ankrd10b LOC106586677 coding upstream 445569 69649537 ~ 69675010 (-)
G291093 NA non-coding downstream 13955 69160171 ~ 69160382 (-)
G291087 NA non-coding downstream 20917 69153212 ~ 69153420 (-)
G291070 LOC106586663 non-coding downstream 45366 69128441 ~ 69128971 (-)
G291010 NA non-coding downstream 143562 69029480 ~ 69030775 (-)
G290954 NA non-coding downstream 258832 68914754 ~ 68915505 (-)
G291137 NA non-coding upstream 51492 69255460 ~ 69255892 (-)
G291139 NA non-coding upstream 54083 69258051 ~ 69258284 (-)
G291148 NA non-coding upstream 81769 69285737 ~ 69286060 (-)
G291546 NA non-coding upstream 95910 69299878 ~ 69300091 (-)
G290713 LOC106586659 other downstream 323483 68846611 ~ 68850854 (-)
G290602 NA other downstream 449423 68721808 ~ 68724914 (-)
G290598 NA other downstream 456952 68710367 ~ 68717385 (-)
G290567 NA other downstream 526717 68626332 ~ 68647620 (-)
G290542 NA other downstream 593630 68579103 ~ 68580707 (-)
G291138 NA other upstream 52037 69256005 ~ 69256544 (-)
G291901 LOC106586687 other upstream 776378 69980346 ~ 69996605 (-)
G291977 NA other upstream 903572 70107540 ~ 70107950 (-)
G292753 NA other upstream 1516068 70720036 ~ 70720591 (-)
G292919 NA other upstream 1823651 71027619 ~ 71040152 (-)

Expression


G291098 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G291098 Expression in each Bioproject

Bar chart with 15 bars.
G291098 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network