G291182



Basic Information


Item Value
gene id G291182
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 69317897 ~ 69318185 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU330168
tggggcggcagggtagcctagtggttagagcgttggactagtaaccggaaggttgcgagttcaaacccccgagctgacaaggtacaaatctgtcattctgcccctgaacaggcagttaacccactgttcctaggccgaaaataagaatttgttcttaactgacttgcctagtaaaataaaaaaaataaagaaataaatatgcatactgtactctataccatcgactgtatccttatgtaatacatgtatcactttgtttacatactcatctcatatgtatatactgtac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU330168 True 289 lncRNA 0.40 1 69317897 69318185

Neighbor


gene id symbol gene type direction distance location
LOC110504559 LOC106586663 coding upstream 151505 68942535 ~ 69172271 (+)
LOC110504548 NA coding upstream 459160 68854772 ~ 68858737 (+)
LOC110520472 LOC106586659 coding upstream 467582 68846508 ~ 68850315 (+)
LOC110504539 LOC106586655 coding upstream 952415 68324426 ~ 68365482 (+)
LOC110520475 LOC106586671 coding downstream 151591 69469776 ~ 69595798 (+)
LOC110520478 LOC106586673 coding downstream 307570 69625755 ~ 69635303 (+)
LOC110520479 LOC106586674 coding downstream 316395 69634580 ~ 69640723 (+)
LOC118964360 NA coding downstream 358325 69676510 ~ 69676663 (+)
LOC110504569 rpgr coding downstream 394163 69712348 ~ 69731657 (+)
G291178 NA non-coding upstream 6079 69311606 ~ 69311818 (+)
G291155 NA non-coding upstream 18961 69298647 ~ 69298936 (+)
G290925 NA non-coding upstream 53544 69260529 ~ 69264353 (+)
G290921 NA non-coding upstream 61047 69256610 ~ 69256850 (+)
G290920 NA non-coding upstream 61682 69255951 ~ 69256215 (+)
G291261 NA non-coding downstream 181363 69499548 ~ 69507478 (+)
G291274 NA non-coding downstream 216236 69534421 ~ 69537258 (+)
G291163 NA non-coding downstream 245479 69563664 ~ 69642030 (+)
G291326 NA non-coding downstream 375830 69694015 ~ 69694249 (+)
G291331 NA non-coding downstream 381563 69699748 ~ 69701720 (+)
G289883 NA other upstream 1092591 68223725 ~ 68225306 (+)
G289517 NA other upstream 1555474 67761737 ~ 67762423 (+)
G289486 NA other upstream 1635775 67678862 ~ 67682122 (+)
G289455 NA other upstream 1685687 67625353 ~ 67632210 (+)
LOC110505416 LOC106586647 other upstream 1797927 67519326 ~ 67520162 (+)
G291327 NA other downstream 377210 69695395 ~ 69695836 (+)
LOC110520485 dynlt3 other downstream 543875 69861894 ~ 69870212 (+)
LOC110504602 LOC106586683 other downstream 600997 69915810 ~ 69923807 (+)
G291461 NA other downstream 631482 69949667 ~ 69952168 (+)

Expression


G291182 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G291182 Expression in each Bioproject

Bar chart with 17 bars.
G291182 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network