G294301



Basic Information


Item Value
gene id G294301
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 72451419 ~ 72451991 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU333784
aatattaacctttctgatctccccatcccggatccgggttcgtgaatacagactcaagctcattaccataacgcaacgttaactattcatgaaaatcgcaaatgaaatgaaataaatatgctagctctcaagcttagccttttgttaacaacactgtcatctcagattttcaaaatatgcttctcaaccattgcaaaacaagcatttgtgtaacagtattgatggctaacgtagcatttagcattagcattcagctggcaacatttacacaaaaaaaacagaaaagcattcaaaaaaatcatttacctttgaagaacttcagatgttttcaatgaggagactctcagatagcaaatgttcagtttttcctgaaagattatttgtttaggacaaatcgctccgttttctgcgtcacgtttagctatgaaaaaacccctgtatccaggattgtgtaaatctatcagcaagctcattagcataacacaacgttaactatttatgaaaatcgcaaatgaaatgaaataaatatgccatctctcaagcttagccttttgtaaacaacactgtcatctc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU333784 True 573 lncRNA 0.35 1 72451419 72451991
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110520529 LOC106586732 coding downstream 184769 72264378 ~ 72266650 (-)
LOC110504660 LOC106582021 coding downstream 244601 72121974 ~ 72206818 (-)
LOC110520523 LOC106582019 coding downstream 336906 72010695 ~ 72114513 (-)
LOC110520527 LOC106586729 coding downstream 445630 71997354 ~ 72005789 (-)
LOC110520524 NA coding downstream 454535 71986320 ~ 71996884 (-)
LOC110520531 LOC106582025 coding upstream 38857 72490848 ~ 72542128 (-)
LOC110504707 NA coding upstream 324725 72776716 ~ 72782874 (-)
LOC110504714 LOC106586779 coding upstream 339313 72791304 ~ 72838453 (-)
LOC110520539 mfsd9 coding upstream 418861 72870852 ~ 72881264 (-)
fhl2a fhl2 coding upstream 573297 73025288 ~ 73039384 (-)
G294292 LOC106561338 non-coding downstream 9289 72441758 ~ 72442130 (-)
G294272 NA non-coding downstream 41282 72409933 ~ 72410137 (-)
G294271 NA non-coding downstream 42642 72408321 ~ 72408777 (-)
G294268 NA non-coding downstream 46470 72404667 ~ 72404949 (-)
G294267 NA non-coding downstream 48283 72402809 ~ 72403136 (-)
G294304 NA non-coding upstream 935 72452926 ~ 72453189 (-)
G294307 NA non-coding upstream 2943 72454934 ~ 72455218 (-)
G294310 NA non-coding upstream 4716 72456707 ~ 72456935 (-)
G294311 NA non-coding upstream 5384 72457375 ~ 72457582 (-)
G294312 NA non-coding upstream 5688 72457679 ~ 72457889 (-)
G293984 NA other downstream 547511 71903314 ~ 71903908 (-)
G292919 NA other downstream 1411267 71027619 ~ 71040152 (-)
G292753 NA other downstream 1730828 70720036 ~ 70720591 (-)
G291977 NA other downstream 2343469 70107540 ~ 70107950 (-)
G294451 NA other upstream 119258 72571249 ~ 72575432 (-)
G294697 NA other upstream 323416 72775407 ~ 72776607 (-)
G296011 NA other upstream 1120301 73572292 ~ 73572911 (-)
G296043 NA other upstream 1180047 73632038 ~ 73633036 (-)

Expression


G294301 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G294301 Expression in each Bioproject

Bar chart with 20 bars.
G294301 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network