G300501



Basic Information


Item Value
gene id G300501
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 78352140 ~ 78352413 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU340893
gtttgtgaatcacttccttttaggtggttgtagaatttaacggctcttttctggattttgataattagtgggtatcggcctaattctgctctgcatgcattatttggtgttctacgttgtacacggaggatatttttgcagaattctgcgtgcagagtctcaatttggtgtttgtcccattttgtgaagtcttggttggtgagcggaccccagacctcacaaccataaagggcaatgggctctatgactgattcaagtatttttagccagatcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG:

id description

RNA


RNA id representative length rna type GC content exon number start site end site
TU340893 True 274 lncRNA 0.42 1 78352140 78352413
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110520639 LOC106586860 coding downstream 110956 78235039 ~ 78241184 (-)
LOC110520637 LOC106586872 coding downstream 124714 78219202 ~ 78227426 (-)
LOC110520638 LOC106586858 coding downstream 131414 78208473 ~ 78220726 (-)
crfb4 crfb4 coding downstream 160474 78174200 ~ 78191666 (-)
LOC110520635 LOC101867533 coding downstream 213616 78112838 ~ 78138524 (-)
LOC110505446 LOC106586894 coding upstream 1620216 79971886 ~ 79987627 (-)
LOC110504879 LOC106586892 coding upstream 1655472 80007885 ~ 80248467 (-)
LOC110520643 LOC106586888 coding upstream 1956006 80308419 ~ 80335869 (-)
LOC110520645 LOC106586879 coding upstream 2064536 80402867 ~ 80421221 (-)
LOC110520647 LOC106595942 coding upstream 2076378 80428791 ~ 80432982 (-)
G300492 NA non-coding downstream 10243 78341098 ~ 78341897 (-)
G300490 NA non-coding downstream 13457 78338167 ~ 78338683 (-)
G300489 NA non-coding downstream 16080 78335581 ~ 78336060 (-)
G300484 NA non-coding downstream 26571 78325245 ~ 78325569 (-)
G300482 NA non-coding downstream 35304 78316609 ~ 78316836 (-)
G300512 NA non-coding upstream 11234 78363647 ~ 78363856 (-)
G300514 NA non-coding upstream 14790 78367203 ~ 78367500 (-)
G300516 NA non-coding upstream 15643 78368056 ~ 78368518 (-)
G300517 NA non-coding upstream 18668 78371081 ~ 78371397 (-)
G300524 NA non-coding upstream 26957 78379370 ~ 78379571 (-)
G300470 NA other downstream 57920 78293783 ~ 78294220 (-)
G300251 NA other downstream 317122 78034485 ~ 78035018 (-)
G300200 NA other downstream 368936 77928486 ~ 77983204 (-)
LOC110520626 ndufv3 other downstream 501374 77844666 ~ 77850842 (-)
pknox1.1 pknox1 other downstream 512925 77832447 ~ 77844072 (-)
G301283 NA other upstream 750936 79103349 ~ 79290938 (-)
G301282 NA other upstream 869685 79222098 ~ 79223310 (-)
G301452 NA other upstream 1097675 79450088 ~ 79450472 (-)
G301453 NA other upstream 1098295 79450708 ~ 79450970 (-)
G301928 NA other upstream 1591638 79944051 ~ 79944434 (-)

Expression


G300501 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G300501 Expression in each Bioproject

Bar chart with 20 bars.
G300501 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network