G300786



Basic Information


Item Value
gene id G300786
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 78687839 ~ 78688127 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU341246
ttaacctctctgatctcccaaacccggatccggtatcgtgactacagcctcaagctcgttaccataacgcaacgttaactattcatgaaaatcgcaaatgaaatgaaataaatatgccatctctcaagcttagccttttgtaaacaacactgtcatctcagattttcaaaatatgcttctcaaccatagaaaaacaataatttgtgtaaaagtagctagctagcgtagcatttagcgttagcattagcgttagcatctagcacgcaacatttcaacaaaaacataaaag

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU341246 True 289 lncRNA 0.37 1 78687839 78688127

Neighbor


gene id symbol gene type direction distance location
LOC110504857 efnb2 coding upstream 160136 78480362 ~ 78527703 (+)
LOC110520642 LOC106586866 coding upstream 212385 78459147 ~ 78475454 (+)
LOC110520640 LOC106586801 coding upstream 402090 78273953 ~ 78285749 (+)
LOC101268957 LOC101867533 coding upstream 515553 78148148 ~ 78172286 (+)
LOC118944722 NA coding upstream 542116 78139884 ~ 78145723 (+)
LOC110520644 LOC106586891 coding downstream 1668817 80356944 ~ 80379895 (+)
LOC110520646 LOC106586886 coding downstream 1715005 80403132 ~ 80416847 (+)
ankrd50l LOC106582487 coding downstream 2022929 80711056 ~ 80734324 (+)
cnga4 cnga4 coding downstream 2200046 80888173 ~ 80903357 (+)
LOC110520655 LOC106586879 coding downstream 2274847 80962974 ~ 80965465 (+)
G300785 NA non-coding upstream 881 78686756 ~ 78686958 (+)
G300781 NA non-coding upstream 3867 78683770 ~ 78683972 (+)
G300777 NA non-coding upstream 10183 78677382 ~ 78677656 (+)
G300737 NA non-coding upstream 76198 78611274 ~ 78611641 (+)
G300626 NA non-coding upstream 147380 78539607 ~ 78540459 (+)
G300788 NA non-coding downstream 1469 78689596 ~ 78689957 (+)
G300789 NA non-coding downstream 2810 78690937 ~ 78692144 (+)
G300871 NA non-coding downstream 74070 78762197 ~ 78762413 (+)
G300892 NA non-coding downstream 99460 78787587 ~ 78787961 (+)
G300919 NA non-coding downstream 127734 78815861 ~ 78816082 (+)
G300596 NA other upstream 202237 78484322 ~ 78485602 (+)
G300026 NA other upstream 674312 77991980 ~ 78013527 (+)
G298906 NA other upstream 1640400 77046690 ~ 77047439 (+)
G298649 NA other upstream 2139719 76546731 ~ 76548120 (+)
G298359 NA other upstream 2370998 76305581 ~ 76316841 (+)
G301063 NA other downstream 273096 78961223 ~ 78968123 (+)
G301814 NA other downstream 1127744 79815871 ~ 79816583 (+)
G301961 NA other downstream 1315458 80003585 ~ 80005155 (+)
G302247 NA other downstream 1616478 80304605 ~ 80308343 (+)
G302420 LOC106586884 other downstream 1862981 80551108 ~ 80552813 (+)

Expression


G300786 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G300786 Expression in each Bioproject

Bar chart with 16 bars.
G300786 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network