G300871



Basic Information


Item Value
gene id G300871
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 78762197 ~ 78762413 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU341335
aacaccttgttcatctagccagcaagtcagatttctaaaatgttttacggcgaaaacatagcacatatatatgtaaaaccaccaccagacacagctcatttgaatagccaaaacatgcaatcaacaaacgcaggattaaaaaataaatcgttcactaaccttttgaaaatcttcatcagatgacagtaatatgacatgttacacagtacatattttt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU341335 True 217 lncRNA 0.34 1 78762197 78762413
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110504857 efnb2 coding upstream 234494 78480362 ~ 78527703 (+)
LOC110520642 LOC106586866 coding upstream 286743 78459147 ~ 78475454 (+)
LOC110520640 LOC106586801 coding upstream 476448 78273953 ~ 78285749 (+)
LOC101268957 LOC101867533 coding upstream 589911 78148148 ~ 78172286 (+)
LOC118944722 NA coding upstream 616474 78139884 ~ 78145723 (+)
LOC110520644 LOC106586891 coding downstream 1594531 80356944 ~ 80379895 (+)
LOC110520646 LOC106586886 coding downstream 1640719 80403132 ~ 80416847 (+)
ankrd50l LOC106582487 coding downstream 1948643 80711056 ~ 80734324 (+)
cnga4 cnga4 coding downstream 2125760 80888173 ~ 80903357 (+)
LOC110520655 LOC106586879 coding downstream 2200561 80962974 ~ 80965465 (+)
G300789 NA non-coding upstream 70053 78690937 ~ 78692144 (+)
G300788 NA non-coding upstream 72240 78689596 ~ 78689957 (+)
G300786 NA non-coding upstream 74070 78687839 ~ 78688127 (+)
G300785 NA non-coding upstream 75239 78686756 ~ 78686958 (+)
G300781 NA non-coding upstream 78225 78683770 ~ 78683972 (+)
G300892 NA non-coding downstream 25174 78787587 ~ 78787961 (+)
G300919 NA non-coding downstream 53448 78815861 ~ 78816082 (+)
G301020 NA non-coding downstream 153765 78916178 ~ 78916389 (+)
G301024 NA non-coding downstream 157404 78919817 ~ 78920081 (+)
G301063 NA non-coding downstream 198810 78961223 ~ 78968123 (+)
G300596 NA other upstream 276595 78484322 ~ 78485602 (+)
G300026 NA other upstream 748670 77991980 ~ 78013527 (+)
G298906 NA other upstream 1714758 77046690 ~ 77047439 (+)
G298649 NA other upstream 2214077 76546731 ~ 76548120 (+)
G298359 NA other upstream 2445356 76305581 ~ 76316841 (+)
G301814 NA other downstream 1053458 79815871 ~ 79816583 (+)
G301961 NA other downstream 1241172 80003585 ~ 80005155 (+)
G302247 NA other downstream 1542192 80304605 ~ 80308343 (+)
G302420 LOC106586884 other downstream 1788695 80551108 ~ 80552813 (+)

Expression


G300871 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G300871 Expression in each Bioproject

Bar chart with 8 bars.
G300871 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network