G301814


Basic Information

Item Value
gene id G301814
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 79815871 ~ 79816583 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU342352
actgataacccaatgagtagactgataacccaatgagaatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtagactgataacccaatgagtagactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtttgactgataacccaatgagtttgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtttgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtttgactgataacccaatgagtttgactgataacccaatgagtatgactgataacccaatgagtatgactgataacccaatgagtatgac

Function

NR:

description
PREDICTED: uncharacterized protein LOC102082365

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU342352 True 713 TUCP 0.38 1 79815871 79816583

Neighbor

gene id symbol gene type direction distance location
LOC110504857 efnb2 coding upstream 1288168 78480362 ~ 78527703 (+)
LOC110520642 LOC106586866 coding upstream 1340417 78459147 ~ 78475454 (+)
LOC110520640 LOC106586801 coding upstream 1530122 78273953 ~ 78285749 (+)
LOC101268957 LOC101867533 coding upstream 1643585 78148148 ~ 78172286 (+)
LOC118944722 NA coding upstream 1670148 78139884 ~ 78145723 (+)
LOC110520644 LOC106586891 coding downstream 540361 80356944 ~ 80379895 (+)
LOC110520646 LOC106586886 coding downstream 586549 80403132 ~ 80416847 (+)
ankrd50l LOC106582487 coding downstream 894473 80711056 ~ 80734324 (+)
cnga4 cnga4 coding downstream 1071590 80888173 ~ 80903357 (+)
LOC110520655 LOC106586879 coding downstream 1146391 80962974 ~ 80965465 (+)
G301811 NA non-coding upstream 1891 79813534 ~ 79813980 (+)
G301792 NA non-coding upstream 26223 79789001 ~ 79789648 (+)
G301790 NA non-coding upstream 27500 79788036 ~ 79788371 (+)
G301731 NA non-coding upstream 85478 79729921 ~ 79730393 (+)
G301730 NA non-coding upstream 86143 79729474 ~ 79729728 (+)
G301817 NA non-coding downstream 4015 79820598 ~ 79820839 (+)
G301828 NA non-coding downstream 16035 79832618 ~ 79832843 (+)
G301830 NA non-coding downstream 17689 79834272 ~ 79834540 (+)
G301836 NA non-coding downstream 19255 79835838 ~ 79836170 (+)
G301850 NA non-coding downstream 43585 79860168 ~ 79860385 (+)
G301063 NA other upstream 847748 78961223 ~ 78968123 (+)
G300596 NA other upstream 1330269 78484322 ~ 78485602 (+)
G300026 NA other upstream 1802344 77991980 ~ 78013527 (+)
G298906 NA other upstream 2768432 77046690 ~ 77047439 (+)
G298649 NA other upstream 3267751 76546731 ~ 76548120 (+)
G301961 NA other downstream 187002 80003585 ~ 80005155 (+)
G302247 NA other downstream 488022 80304605 ~ 80308343 (+)
G302420 LOC106586884 other downstream 734525 80551108 ~ 80552813 (+)
G302492 NA other downstream 932011 80748594 ~ 80749620 (+)
G302502 cssa25h11orf42 other downstream 963211 80779794 ~ 80780318 (+)

Expression

G301814 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G301814 Expression in each Bioproject

Bar chart with 1 bar.
G301814 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network