G304133



Basic Information


Item Value
gene id G304133
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 82759256 ~ 82759546 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU345258
gtttaacagtctgatggccttgagatagaagctgtttttcagtctctcggtcccagctttgatgcacctgtactgacctcgccttctggatgatagcggggtgaacaggcagtggctcgggtggttgttgtccttgatgatctttatggccttcctgtgacatcaggtggtgtaggtgtcctggagggcaggtagtttgcccccggtgatgcgttgtgcagacctcactaccctctggagagccttacggttgtgggcggagcagttgccgtaccaggcggtgatacagcc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU345258 True 291 lncRNA 0.55 1 82759256 82759546
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110505453 LOC106586926 coding downstream 11522 82744854 ~ 82747738 (-)
pard3bb LOC106601765 coding downstream 173174 82297732 ~ 82586082 (-)
LOC110520662 des coding downstream 616175 82105898 ~ 82143081 (-)
LOC110510426 bin1 coding downstream 718557 81994051 ~ 82040699 (-)
LOC110504940 LOC106586933 coding upstream 145940 82905486 ~ 83193706 (-)
ttll4 ttll4 coding upstream 723907 83483453 ~ 83539355 (-)
abcb6b LOC106586936 coding upstream 787376 83546922 ~ 83612879 (-)
LOC110520669 LOC106586940 coding upstream 867023 83626569 ~ 83629281 (-)
LOC110505466 LOC106586938 coding upstream 879544 83639090 ~ 83643367 (-)
G304111 NA non-coding downstream 1625 82694100 ~ 82757631 (-)
G304075 NA non-coding downstream 78047 82680989 ~ 82681209 (-)
G304072 NA non-coding downstream 83879 82675049 ~ 82675377 (-)
G304068 NA non-coding downstream 87513 82671495 ~ 82671743 (-)
G304044 NA non-coding downstream 131607 82622978 ~ 82627649 (-)
G304137 NA non-coding upstream 1373 82760919 ~ 82761408 (-)
G304217 NA non-coding upstream 17067 82776613 ~ 82776903 (-)
G304218 NA non-coding upstream 43138 82802684 ~ 82803096 (-)
G304219 NA non-coding upstream 43590 82803136 ~ 82805098 (-)
G304228 NA non-coding upstream 60603 82820149 ~ 82820430 (-)
G303665 NA other downstream 735805 82022829 ~ 82023451 (-)
G303663 NA other downstream 736991 82021388 ~ 82022265 (-)
G302725 NA other downstream 2036633 80721738 ~ 80722623 (-)
G304204 LOC107714908 other upstream 71824 82831370 ~ 82851751 (-)
G304264 NA other upstream 190523 82950069 ~ 82951356 (-)
abi2a LOC106574254 other upstream 1196198 83915872 ~ 83986617 (-)
LOC110504983 LOC106586944 other upstream 1320475 84072966 ~ 84220262 (-)
G305189 NA other upstream 1421505 84181051 ~ 84182035 (-)

Expression


G304133 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G304133 Expression in each Bioproject

Bar chart with 20 bars.
G304133 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network