G304948


Basic Information

Item Value
gene id G304948
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 83939207 ~ 83940943 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU346288
gtgtcccaccaaaccctcttttacgctgctgctactctcggttgattatctatgcatagtcactttaactaatcctacatgtgcatattacctcaattagcccgactaaccggtgccccacacattgactctgtaccagtaccccctgtatatagcctccacattgactctgtaacggtaccccctgtatatagcctccacattatctctgtaccggtaccccctgtatatagccttcacattgactctgtaccggtaccccctgtatataacctccacattgactctgtaccggtaccccctgtatatatcctccacattgactctgtaccggtaccccctgtatatagcctccacattgactctgtaccgtaataccctgtatatagcctccacattgactctgtaccggtacaccctgtatatagcctccacattgactctgtaccggtaccccctgtatattgcctccacattgactctgtaccggtaccccctgtatatagcctccacattgactctgtaccggtaccccctgtatatagcctccacattgactctgtaccg

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU346288 True 567 TUCP 0.48 2 83939207 83940943
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110520666 LOC106586946 coding upstream 44788 83774817 ~ 83894419 (+)
LOC110518299 LOC103024068 coding upstream 496011 83440988 ~ 83443196 (+)
LOC110519361 LOC106586922 coding upstream 1041182 82855387 ~ 82898025 (+)
LOC110513696 LOC106586921 coding upstream 1085564 82849989 ~ 82853643 (+)
LOC110511912 tba coding upstream 1104259 82831442 ~ 82834948 (+)
LOC110520680 c1ql4 coding downstream 65530 84006473 ~ 84007610 (+)
LOC110504992 LOC106591519 coding downstream 76639 84017582 ~ 84066662 (+)
LOC118964338 NA coding downstream 146766 84087709 ~ 84088210 (+)
igf2bp2a igf2bp2 coding downstream 736192 84677135 ~ 84761793 (+)
LOC110520675 LOC106586959 coding downstream 935657 84876600 ~ 84892536 (+)
G304947 NA non-coding upstream 466 83938493 ~ 83938741 (+)
G304940 NA non-coding upstream 11083 83927839 ~ 83928124 (+)
G304937 NA non-coding upstream 12923 83926027 ~ 83926284 (+)
G304936 NA non-coding upstream 13314 83925680 ~ 83925893 (+)
G304935 NA non-coding upstream 13536 83925217 ~ 83925671 (+)
G304949 NA non-coding downstream 13393 83954336 ~ 83954809 (+)
G304962 NA non-coding downstream 45818 83986761 ~ 83987388 (+)
G304979 NA non-coding downstream 68548 84009491 ~ 84010832 (+)
G304978 NA non-coding downstream 71619 84012562 ~ 84014332 (+)
G304989 NA non-coding downstream 84505 84025448 ~ 84026949 (+)
G304931 NA other upstream 16202 83922485 ~ 83923005 (+)
G304929 NA other upstream 21393 83916885 ~ 83917814 (+)
G304430 NA other upstream 694387 83242370 ~ 83244820 (+)
G304158 NA other upstream 1111191 82827374 ~ 82828016 (+)
G303803 LOC106601765 other upstream 1624969 82292871 ~ 82314238 (+)
G305035 NA other downstream 212135 84153078 ~ 84162522 (+)
G305238 NA other downstream 373636 84312762 ~ 84315547 (+)
G305256 LOC103150597 other downstream 432717 84373660 ~ 84374128 (+)
G305614 NA other downstream 960108 84901051 ~ 84909355 (+)

Expression

G304948 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G304948 Expression in each Bioproject

Bar chart with 19 bars.
G304948 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network