G305257



Basic Information


Item Value
gene id G305257
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048567.1
NCBI id CM023221.2
chromosome length 85311031
location 84375820 ~ 84376090 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU346681
tggaccaggctaggatagtatggttctgttatagatctgggaccaggctaggatagtatggttctgttatagatctgggaccaggctaggatagtatggttctgttatagatctgggaccaggctaggatagtatggttctgttatagatctgggaccaggctaggatagtatggttctgttatagatctgggaccaggctaggatagtgtggttctgttatagatctggaccaggctaggatagtatggttctgttatagatctgggacc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU346681 True 271 lncRNA 0.45 1 84375820 84376090

Neighbor


gene id symbol gene type direction distance location
LOC118964338 NA coding upstream 287610 84087709 ~ 84088210 (+)
LOC110504992 LOC106591519 coding upstream 309238 84017582 ~ 84066662 (+)
LOC110520680 c1ql4 coding upstream 368210 84006473 ~ 84007610 (+)
LOC110520666 LOC106586946 coding upstream 481401 83774817 ~ 83894419 (+)
LOC110518299 LOC103024068 coding upstream 932624 83440988 ~ 83443196 (+)
igf2bp2a igf2bp2 coding downstream 301045 84677135 ~ 84761793 (+)
LOC110520675 LOC106586959 coding downstream 500510 84876600 ~ 84892536 (+)
LOC110518240 LOC106591790 coding downstream 721174 85097264 ~ 85227397 (+)
G305255 NA non-coding upstream 3634 84371960 ~ 84372186 (+)
G305254 NA non-coding upstream 7787 84367794 ~ 84368033 (+)
G305253 NA non-coding upstream 20952 84354539 ~ 84354868 (+)
G305251 NA non-coding upstream 25271 84350312 ~ 84350549 (+)
G305250 NA non-coding upstream 25563 84349679 ~ 84350257 (+)
G305262 NA non-coding downstream 23623 84399713 ~ 84400122 (+)
G305263 NA non-coding downstream 27449 84403539 ~ 84403769 (+)
G305264 NA non-coding downstream 28797 84404887 ~ 84405121 (+)
G305265 NA non-coding downstream 29847 84405937 ~ 84406146 (+)
G305267 NA non-coding downstream 32489 84408579 ~ 84409156 (+)
G305256 LOC103150597 other upstream 1692 84373660 ~ 84374128 (+)
G305238 NA other upstream 60273 84312762 ~ 84315547 (+)
G305035 NA other upstream 213298 84153078 ~ 84162522 (+)
G304948 NA other upstream 434877 83939207 ~ 83940943 (+)
G304931 NA other upstream 452815 83922485 ~ 83923005 (+)
G305614 NA other downstream 524961 84901051 ~ 84909355 (+)

Expression


G305257 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G305257 Expression in each Bioproject

Bar chart with 8 bars.
G305257 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.

Co-expression Network