LOC110520969 (fut9)



Basic Information


Item Value
gene id LOC110520969
gene name fut9
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 13784714 ~ 13785790 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XM_021598417.2
ATGGCAACTGCAACTCTTAACGGCTTACTGCGCCTACTTGTGACTGCAATCATTGCAATAGGCTGTTTTGTGACTGTTTTCCTCATGTATTTTAAACCGTCAGGTAACTGGCTTGCAAAGCCCATTGAATCATCAACACTACCAATTCAGAAGGAAGTAGAAGAAAATAAGGCTCATAATAAGACTATAGTTCTATTATGGATGTGGCCTTTTGGTCAGTCCTATGATCTAGACACTTGCAGCACCCTGTTCAATATTGAAGGCTGTTTTTTAACAGCTGACCGAGACCTATACAATAAGTCAAGTGGGGTCATCATTCACCATCGAGACATAAAAAGTGATTTATCAAATCTACCACCATTGCAGCGCCCACCTTTCCAAAAGTGGGTGTGGATGAATCTAGAGTCCCCGTCACATACTTATAAAAACCCAGGTCTTGGAAATATTTTCAATTTGACTTTGAATTATAGGCAAGACGCAGATATTGAAGTGCCTTATGGGTCAGTTGTATTCAGCCAAAAGGAGGGGGAAGCTTTCGTATTGCCAATTAAAACTAAATTGGTCTGCTGGATTGTGAGTAACTGGAACCCTGACCATGCCAGAGCAAGGTACTTCAATGAATTGCACAAACACATCGAGATACACACCTATGGAAAAGCCTTTGGAGAACACGTCAATGATCAAGACTTCCTGGACACAATATCCAGTTGTAAATTCTATCTTTCGTTTGAGAACTCGATTCACAAAGACTACATCACTGAAAAGCTGTACAACCCACTAGCTGCTGGATCTGTGCCCATTGCTCTTGGGCCACCTAGGCAGAACTATGAGAACTTTGTGCCTGGAGATGCCTTCATACATGTGGATGATTTCCTCTCTCCCAAAGAGCTGGCTAACCAACTCACACTGTTACATACAAATGAACAAATGTATCTGCGGTATTTTGAGTGGCGCAGACATTTCAATGTCAAGAGGTCACATTTCTGGGCTGAACACACATGTCATGCCTGCGATTACATTAAAAGACACAATGAATATAAAGTTTGTAATAACCTTGACACTTGGTTTTGGGGTTGA

Function


symbol description
fut9 Enables 4-galactosyl-N-acetylglucosaminide 3-alpha-L-fucosyltransferase activity. Involved in several processes, including fucosylation; positive regulation of neuron projection development; and regulation of leukocyte tethering or rolling. Located in trans-Golgi network membrane.

NR:

description
alpha-(1,3)-fucosyltransferase 9-like

GO:

id name namespace
GO:0036065 fucosylation biological_process
GO:0006486 protein glycosylation biological_process
GO:0032580 Golgi cisterna membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008417 fucosyltransferase activity molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XM_021598417.2 True 1077 mRNA 0.42 1 13784714 13785790

Neighbor


gene id symbol gene type direction distance location
LOC110522121 gja10 coding upstream 735579 13047347 ~ 13049135 (+)
LOC110522103 casp8ap2 coding upstream 739051 13034144 ~ 13045663 (+)
LOC110521046 LOC106607715 coding upstream 803122 12928115 ~ 12981592 (+)
LOC110522108 pm20d2 coding upstream 972337 12800778 ~ 12812377 (+)
pnrc1 pnrc1 coding upstream 986603 12794904 ~ 12798111 (+)
LOC110522126 LOC106607723 coding downstream 6194 13791984 ~ 13801419 (+)
LOC110522131 LOC106607727 coding downstream 122529 13908319 ~ 13914582 (+)
LOC110522133 LOC106607729 coding downstream 148802 13934592 ~ 13954337 (+)
LOC110522134 LOC106607731 coding downstream 278554 14064344 ~ 14131367 (+)
LOC110522137 hdac2 coding downstream 425634 14211424 ~ 14219757 (+)
G322601 NA non-coding upstream 30342 13754167 ~ 13754372 (+)
G322579 NA non-coding upstream 48531 13735973 ~ 13736183 (+)
G322518 NA non-coding upstream 100353 13684106 ~ 13684361 (+)
G322496 NA non-coding upstream 114402 13670101 ~ 13670312 (+)
G322337 NA non-coding upstream 216030 13568430 ~ 13568684 (+)
G322636 LOC106607725 non-coding downstream 51264 13837054 ~ 13855757 (+)
G322650 NA non-coding downstream 72448 13858238 ~ 13860123 (+)
G322685 NA non-coding downstream 137846 13923636 ~ 13926446 (+)
G322701 NA non-coding downstream 170370 13956160 ~ 13956967 (+)
G322861 NA non-coding downstream 185230 13971020 ~ 13971233 (+)
G321447 NA other upstream 641271 13142947 ~ 13143443 (+)
LOC110522117 smim8 other upstream 1235600 12548411 ~ 12549119 (+)
LOC110522079 LOC106607678 other upstream 2406958 11376071 ~ 11378586 (+)
G322645 NA other downstream 64497 13850287 ~ 13885503 (+)
G325389 fabp7 other downstream 2649463 16435253 ~ 16436882 (+)
G327705 NA other downstream 4478500 18264290 ~ 18304442 (+)
G327995 LOC106607813 other downstream 4641364 18427154 ~ 18428907 (+)
G328474 NA other downstream 4971065 18756855 ~ 18757545 (+)

Expression



Co-expression Network