LOC118964509



Basic Information


Item Value
gene id LOC118964509
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 43287182 ~ 43287259 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005051570.1
GCTTGTGTGATGATTTACTTTCTTTAGTCGGATACCCCTTCACTTCAAATTATGAGTGAGATCCCCTGTCTGACACGC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005051570.1 True 78 mRNA 0.44 1 43287182 43287259
Loading

Neighbor


gene id symbol gene type direction distance location
sh3bgrl2 LOC106608335 coding upstream 8867 43253892 ~ 43279017 (+)
si:dkey-71h2.2 LOC104922452 coding upstream 656666 42521786 ~ 42630516 (+)
si:ch211-278j3.3 LOC106608328 coding upstream 772721 42460358 ~ 42514461 (+)
LOC110522651 LOC106608319 coding upstream 854053 42370820 ~ 42433129 (+)
eif2b4 LOC106608321 coding upstream 922828 42329742 ~ 42364354 (+)
tbpl1 tbpl1 coding downstream 416760 43704019 ~ 43722541 (+)
slc2a12 slc2a12 coding downstream 453004 43740263 ~ 43768983 (+)
myb myb coding downstream 797357 44084616 ~ 44110268 (+)
ppp1r14c ppp1r14c coding downstream 1022214 44309473 ~ 44336978 (+)
nbas LOC104962557 coding downstream 1114057 44401316 ~ 44700404 (+)
G353963 NA non-coding upstream 3334 43282041 ~ 43283848 (+)
G353940 NA non-coding upstream 6516 43279806 ~ 43280666 (+)
G353952 NA non-coding upstream 40279 43246663 ~ 43246903 (+)
G353950 NA non-coding upstream 54628 43232135 ~ 43232554 (+)
G353944 NA non-coding upstream 81101 43205564 ~ 43206081 (+)
G353968 NA non-coding downstream 7241 43294500 ~ 43294783 (+)
G353969 NA non-coding downstream 7751 43295010 ~ 43295264 (+)
G353970 NA non-coding downstream 12036 43299295 ~ 43300099 (+)
G353978 NA non-coding downstream 24714 43311973 ~ 43312920 (+)
G353979 NA non-coding downstream 25959 43313218 ~ 43318002 (+)
G353820 NA other upstream 375005 42910886 ~ 42912213 (+)
G353339 NA other upstream 835773 42451032 ~ 42451409 (+)
G353328 LOC106608329 other upstream 843801 42442755 ~ 42443381 (+)
LOC118964483 NA other upstream 958545 42319401 ~ 42328637 (+)
G354462 NA other downstream 323703 43610962 ~ 43611562 (+)
G354630 NA other downstream 702864 43990123 ~ 43990639 (+)
G354819 NA other downstream 1172434 44459693 ~ 44461991 (+)
G355413 NA other downstream 1687777 44975036 ~ 44975829 (+)

Expression


LOC118964509 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

LOC118964509 Expression in each Bioproject

Bar chart with 7 bars.
LOC118964509 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2500.
End of interactive chart.

Co-expression Network