G312864



Basic Information


Item Value
gene id G312864
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 5366647 ~ 5367058 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU354917
caaaacctaggaagaaacctagagaggaaccaggctatgtggggtggccagtcctcttctggctgtgccgggtggagattataacaaaacatggtcaagatgttcaaatgttcataaatgaccagcatggtcgaataataataaggcagaatagttgaaactggagcagcagcacagtcaggtggactggggacagcaaggagtcatcatgtcaggtattcctggggcatggtcctagggctcaggtcctccgagagagggaaagaaagagagaattagagagagcatatgtgggatggccagtcctcttctggctgtgccgggtggagattataacagaacatggccaagatgttcaaatgttcataaatgaccagcatggtcgaataataataaggcagaacagttgaaa

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU354917 True 412 lncRNA 0.47 1 5366647 5367058

Neighbor


gene id symbol gene type direction distance location
LOC110521031 LOC106607646 coding downstream 29826 5203325 ~ 5336821 (-)
LOC110521984 LOC106607649 coding downstream 245777 5113893 ~ 5120870 (-)
LOC110521982 LOC106607651 coding downstream 341657 5009876 ~ 5024990 (-)
LOC110521981 LOC106607650 coding downstream 357390 4933975 ~ 5009257 (-)
LOC110521979 LOC106607652 coding downstream 520978 4810320 ~ 4845669 (-)
LOC110521989 LOC106607642 coding upstream 191877 5558935 ~ 5580102 (-)
LOC118964391 NA coding upstream 219190 5586248 ~ 5587296 (-)
LOC110521991 LOC106607640 coding upstream 406881 5773939 ~ 5778108 (-)
LOC110521996 LOC106607551 coding upstream 826218 6193276 ~ 6200262 (-)
LOC110521999 LOC106587059 coding upstream 1153004 6520062 ~ 6524760 (-)
G312832 NA non-coding downstream 63350 5303024 ~ 5303297 (-)
G312784 NA non-coding downstream 178418 5187881 ~ 5188229 (-)
G312781 NA non-coding downstream 181073 5185319 ~ 5185574 (-)
G312776 NA non-coding downstream 186212 5180135 ~ 5180435 (-)
G312768 NA non-coding downstream 189989 5174765 ~ 5176658 (-)
G312869 NA non-coding upstream 10809 5377867 ~ 5378643 (-)
G312881 NA non-coding upstream 41016 5408074 ~ 5408506 (-)
G312932 NA non-coding upstream 99812 5466870 ~ 5543762 (-)
G312956 NA non-coding upstream 124244 5491302 ~ 5492115 (-)
G312964 NA non-coding upstream 129572 5496630 ~ 5497386 (-)
G311859 NA other downstream 1143336 4190120 ~ 4223311 (-)
LOC118964401 LOC106591690 other downstream 1168686 4193595 ~ 4197990 (-)
G311694 NA other downstream 1436591 3929720 ~ 3930056 (-)
G308195 NA other downstream 3683608 1680178 ~ 1683039 (-)
G314127 NA other upstream 1117268 6484326 ~ 6491453 (-)
LOC110522000 LOC106607553 other upstream 1230514 6590264 ~ 6599823 (-)
LOC110521035 LOC106607558 other upstream 1531089 6871876 ~ 6970539 (-)
G314912 LOC106607559 other upstream 1822473 7189531 ~ 7189910 (-)
G315249 LOC106607562 other upstream 2052781 7419839 ~ 7431757 (-)

Expression


G312864 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G312864 Expression in each Bioproject

Bar chart with 21 bars.
G312864 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network