G316280



Basic Information


Item Value
gene id G316280
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 8404817 ~ 8406317 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU358592
gcacacacacacagaggcacacacacacagaggcacacacacacagaggcacacacacagaggcacacacacagaggcacacacacagaggcacacacacacagaggcacacacacacacagaggcacacacacacagaggcacacacacacacagaggcacacacacacagagaggcacacacacacagagaggcacacacacagaggcacacacacagaggcgcgcgcacacacacaggcgcgtgcacacacacaggcacgcacacacaggcacgcacacacaggcacgcacacacaggcacgcacacacaggcacgcacacacaggcacgcacacacaggcacgcaca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU358592 True 351 lncRNA 0.60 2 8404817 8406317

Neighbor


gene id symbol gene type direction distance location
LOC110522025 ints7 coding downstream 85126 8309484 ~ 8319691 (-)
LOC110522024 LOC106607581 coding downstream 96403 8223245 ~ 8308414 (-)
LOC110522023 LOC106607573 coding downstream 189062 8207113 ~ 8215755 (-)
LOC110522022 LOC106607574 coding downstream 213996 8183856 ~ 8190821 (-)
LOC110522021 LOC106607576 coding downstream 282501 8112317 ~ 8122316 (-)
LOC110522030 LOC106607586 coding upstream 185087 8591404 ~ 8615635 (-)
LOC110522031 LOC100380852 coding upstream 210020 8616337 ~ 8684888 (-)
LOC110522036 LOC106607590 coding upstream 698016 9104333 ~ 9133947 (-)
LOC110522038 LOC106607592 coding upstream 794330 9200647 ~ 9206289 (-)
LOC118964406 LOC106607592 coding upstream 836392 9242654 ~ 9279556 (-)
G316157 NA non-coding downstream 181726 8222765 ~ 8223091 (-)
G316155 NA non-coding downstream 182394 8222180 ~ 8222423 (-)
G316024 NA non-coding downstream 182762 8221525 ~ 8222055 (-)
G316017 NA non-coding downstream 187555 8217001 ~ 8217262 (-)
G316316 NA non-coding upstream 50495 8456812 ~ 8457053 (-)
G316317 NA non-coding upstream 51369 8457686 ~ 8458173 (-)
G316325 NA non-coding upstream 55054 8461371 ~ 8461904 (-)
G316594 NA non-coding upstream 130439 8536756 ~ 8537283 (-)
G316586 NA non-coding upstream 166332 8572649 ~ 8591276 (-)
G315805 LOC106597702 other downstream 572756 7816293 ~ 7832061 (-)
LOC110522016 LOC106598538 other downstream 591690 7807918 ~ 7818393 (-)
G315249 LOC106607562 other downstream 973060 7419839 ~ 7431757 (-)
G314912 LOC106607559 other downstream 1214907 7189531 ~ 7189910 (-)
LOC110521035 LOC106607558 other downstream 1471208 6871876 ~ 6970539 (-)
G316845 NA other upstream 445853 8852170 ~ 8853030 (-)
LOC118964435 LOC106607592 other upstream 874603 9280920 ~ 9282086 (-)
LOC110513790 LOC106607592 other upstream 909669 9309373 ~ 9318116 (-)

Expression


G316280 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G316280 Expression in each Bioproject

Bar chart with 14 bars.
G316280 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network