G317770



Basic Information


Item Value
gene id G317770
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 9816540 ~ 9816870 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU360255
gcacacttgttgtttgtgtacatggattttataatgtcgtatgttttacccccaacaccactttccatcagtttgtatagcagaccctcatgccaaattgagtcaaaggcttttttgaaatcaacaaagcatgagaagactttgcctttgttttggtttgtttggttgtcaattagggtgtgcagggtgaatacatggtctgttgtatggtaatttggtaaaaagccaatttgacatttgctcagtacattgttttcattgaggaaatgtacgagtctgctgttaatgataatgcagaggattttcccaaggttactgttgacgcatattc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU360255 True 331 lncRNA 0.38 1 9816540 9816870
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110522049 LOC106607598 coding upstream 155784 9658281 ~ 9660756 (+)
LOC110522048 LOC106607600 coding upstream 247048 9557541 ~ 9569492 (+)
LOC110522047 ikbe coding upstream 260799 9546210 ~ 9555741 (+)
LOC118964431 LOC106571213 coding upstream 343923 9447091 ~ 9472617 (+)
LOC118964434 LOC106571213 coding upstream 382174 9420760 ~ 9434366 (+)
LOC110522052 LOC106605670 coding downstream 68016 9884886 ~ 9886596 (+)
sox11b LOC100135787 coding downstream 249696 10066566 ~ 10068867 (+)
rnf144ab LOC106607656 coding downstream 528807 10345677 ~ 10351736 (+)
LOC110522055 id2 coding downstream 623115 10439985 ~ 10442233 (+)
si:ch211-195d17.2 e2f6 coding downstream 742054 10558924 ~ 10565079 (+)
G317747 NA non-coding upstream 12753 9803384 ~ 9803787 (+)
G317740 NA non-coding upstream 21512 9794796 ~ 9795028 (+)
G317737 NA non-coding upstream 23096 9793233 ~ 9793444 (+)
G317438 NA non-coding upstream 23589 9727583 ~ 9792951 (+)
G317402 NA non-coding upstream 119656 9683153 ~ 9696884 (+)
G317778 NA non-coding downstream 5142 9822012 ~ 9822431 (+)
G317780 NA non-coding downstream 5919 9822789 ~ 9823099 (+)
G317784 NA non-coding downstream 8525 9825395 ~ 9825779 (+)
G317885 NA non-coding downstream 133468 9950338 ~ 10113168 (+)
G318199 NA non-coding downstream 305552 10122422 ~ 10122630 (+)
G317265 NA other upstream 396211 9419418 ~ 9420329 (+)
LOC110521039 NA other upstream 586023 9212373 ~ 9241817 (+)
G316996 NA other upstream 777371 9038700 ~ 9039169 (+)
LOC110522033 LOC106571210 other upstream 1015035 8738411 ~ 8802455 (+)
LOC110522079 LOC106607678 other downstream 1559357 11376071 ~ 11378586 (+)
LOC110522117 smim8 other downstream 2731600 12548411 ~ 12549119 (+)
LOC110522108 pm20d2 other downstream 2983966 12800778 ~ 12812377 (+)
LOC110521046 LOC106607715 other downstream 3163530 12928115 ~ 12981592 (+)
G321447 NA other downstream 3326077 13142947 ~ 13143443 (+)

Expression


G317770 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G317770 Expression in each Bioproject

Bar chart with 20 bars.
G317770 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2000.
End of interactive chart.

Co-expression Network