G326395



Basic Information


Item Value
gene id G326395
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 16936796 ~ 16937208 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU369574
TGGAATGTAGCCTAGGTTAGGTAGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGTTAGGTGGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGTTAGGTGGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGTTAGGTGGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGTTAGGTAGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGTTAGGTAGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGTTAGGTGGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGTTAGGTGGTTTGTAGGGAGATTATAGGATGGAATGTAGCCTAGGT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU369574 True 369 lncRNA 0.43 2 16936796 16937208
Loading

Neighbor


gene id symbol gene type direction distance location
hsdl1 hsdl1 coding downstream 268743 16665910 ~ 16668053 (-)
gja11 LOC106607914 coding downstream 271471 16663179 ~ 16665325 (-)
gja13.2 LOC106607776 coding downstream 273875 16660751 ~ 16662921 (-)
LOC110522204 LOC106607913 coding downstream 276932 16656912 ~ 16659864 (-)
LOC110522201 LOC106571520 coding downstream 289214 16645396 ~ 16647582 (-)
LOC110522210 NA coding upstream 325076 17262052 ~ 17269520 (-)
LOC110521050 NA coding upstream 359102 17296310 ~ 17309948 (-)
slc35f1 LOC106607784 coding upstream 375298 17312506 ~ 17425412 (-)
nus1 LOC106607785 coding upstream 501153 17438361 ~ 17451037 (-)
dcbld1 LOC106607786 coding upstream 536755 17473963 ~ 17510002 (-)
G326166 NA non-coding downstream 127353 16809145 ~ 16809443 (-)
G326164 NA non-coding downstream 129398 16806500 ~ 16807398 (-)
G326161 NA non-coding downstream 131134 16805408 ~ 16805662 (-)
G326048 NA non-coding downstream 211399 16725165 ~ 16725397 (-)
G326043 NA non-coding downstream 214062 16722467 ~ 16722734 (-)
G326465 NA non-coding upstream 83562 17020770 ~ 17021034 (-)
G327013 NA non-coding upstream 136094 17073302 ~ 17099998 (-)
G327020 NA non-coding upstream 146367 17083575 ~ 17084127 (-)
G327105 NA non-coding upstream 303183 17240391 ~ 17250692 (-)
G325960 LOC106607776 other downstream 273915 16646755 ~ 16662881 (-)
G325696 NA other downstream 596089 16339332 ~ 16340707 (-)
rnf217 rnf217 other downstream 832108 16019428 ~ 16125180 (-)
G324432 NA other downstream 1681788 15253864 ~ 15255008 (-)
G323167 prs27 other downstream 2749625 14128489 ~ 14187171 (-)
vgll2a LOC106607788 other upstream 625662 17559268 ~ 17566213 (-)
G327409 LOC106607793 other upstream 857982 17795190 ~ 17800469 (-)
LOC110522229 LOC106607809 other upstream 1346569 18022013 ~ 18286490 (-)
G328236 NA other upstream 1509375 18446583 ~ 18447030 (-)
G328760 NA other upstream 1857898 18795022 ~ 18862375 (-)

Expression


G326395 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G326395 Expression in each Bioproject

Bar chart with 16 bars.
G326395 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network