G327013



Basic Information


Item Value
gene id G327013
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 17073302 ~ 17099998 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU370247
ctgtgattattattggaccctgctggtcatctatgaacatttgaacatctggccttaatggccatgtactcttataatctccatccggcacagccagaagaggactggccacccttcagagcctggttcctctctaggtttcttcctaggttttggcctttctagggagtttttcctagccaccgtgcttctacacctgcattgcttgctgtttggggttttaggctgggtttctgtacagcactttgagatatcagctgatataagaagggctatataaatacattt

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU370247 True 288 lncRNA 0.45 2 17073302 17099998
Loading

Neighbor


gene id symbol gene type direction distance location
hsdl1 hsdl1 coding downstream 405249 16665910 ~ 16668053 (-)
gja11 LOC106607914 coding downstream 407977 16663179 ~ 16665325 (-)
gja13.2 LOC106607776 coding downstream 410381 16660751 ~ 16662921 (-)
LOC110522204 LOC106607913 coding downstream 413438 16656912 ~ 16659864 (-)
LOC110522201 LOC106571520 coding downstream 425720 16645396 ~ 16647582 (-)
LOC110522210 NA coding upstream 162286 17262052 ~ 17269520 (-)
LOC110521050 NA coding upstream 196312 17296310 ~ 17309948 (-)
slc35f1 LOC106607784 coding upstream 212508 17312506 ~ 17425412 (-)
nus1 LOC106607785 coding upstream 338363 17438361 ~ 17451037 (-)
dcbld1 LOC106607786 coding upstream 373965 17473963 ~ 17510002 (-)
G326465 NA non-coding downstream 52268 17020770 ~ 17021034 (-)
G326395 NA non-coding downstream 136094 16936796 ~ 16937208 (-)
G326166 NA non-coding downstream 263859 16809145 ~ 16809443 (-)
G326164 NA non-coding downstream 265904 16806500 ~ 16807398 (-)
G326161 NA non-coding downstream 267640 16805408 ~ 16805662 (-)
G327105 NA non-coding upstream 140393 17240391 ~ 17250692 (-)
G327268 NA non-coding upstream 416017 17516015 ~ 17530132 (-)
LOC110521052 afdn non-coding upstream 529236 17629230 ~ 17746634 (-)
G327387 NA non-coding upstream 680131 17780129 ~ 17788571 (-)
G325960 LOC106607776 other downstream 410421 16646755 ~ 16662881 (-)
G325696 NA other downstream 732595 16339332 ~ 16340707 (-)
rnf217 rnf217 other downstream 968614 16019428 ~ 16125180 (-)
G324432 NA other downstream 1818294 15253864 ~ 15255008 (-)
G323167 prs27 other downstream 2886131 14128489 ~ 14187171 (-)
vgll2a LOC106607788 other upstream 462872 17559268 ~ 17566213 (-)
G327409 LOC106607793 other upstream 695192 17795190 ~ 17800469 (-)
LOC110522229 LOC106607809 other upstream 1183779 18022013 ~ 18286490 (-)
G328236 NA other upstream 1346585 18446583 ~ 18447030 (-)
G328760 NA other upstream 1695108 18795022 ~ 18862375 (-)

Expression


G327013 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G327013 Expression in each Bioproject

Bar chart with 19 bars.
G327013 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network