G327268



Basic Information


Item Value
gene id G327268
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048568.1
NCBI id CM023222.3
chromosome length 46841314
location 17516015 ~ 17530132 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU370533
tttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaaatgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgttagtctctcgatgtgcaaaactgatagagacataccccaagcgacttacagctgtaatcgcagcaaaaggtggcgctacaaagtattaacttaagggggctgaataattttgcacgcccaatttttcagtttttgatttgttaaaaaagtttgaaatatccaataaatttcgttccacttcatgattgtgtcccacttgttgttgattc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU370533 True 473 lncRNA 0.39 2 17516015 17530132
Loading

Neighbor


gene id symbol gene type direction distance location
dcbld1 LOC106607786 coding downstream 6013 17473963 ~ 17510002 (-)
nus1 LOC106607785 coding downstream 64978 17438361 ~ 17451037 (-)
slc35f1 LOC106607784 coding downstream 90603 17312506 ~ 17425412 (-)
LOC110521050 NA coding downstream 206067 17296310 ~ 17309948 (-)
LOC110522210 NA coding downstream 246495 17262052 ~ 17269520 (-)
vgll2a LOC106607788 coding upstream 29136 17559268 ~ 17566213 (-)
rfx6 LOC106607790 coding upstream 69079 17599211 ~ 17606551 (-)
trnal-cag-2 NA coding upstream 95346 17625478 ~ 17625560 (-)
LOC110521052 afdn coding upstream 99098 17629230 ~ 17746634 (-)
si:ch211-140l13.3 LOC106607793 coding upstream 264215 17794347 ~ 17800790 (-)
G327105 NA non-coding downstream 265323 17240391 ~ 17250692 (-)
G327013 NA non-coding downstream 416017 17073302 ~ 17099998 (-)
G327020 NA non-coding downstream 431888 17083575 ~ 17084127 (-)
G326465 NA non-coding downstream 494981 17020770 ~ 17021034 (-)
G327387 NA non-coding upstream 249997 17780129 ~ 17788571 (-)
G327384 unc93a non-coding upstream 250888 17781020 ~ 17781886 (-)
G327370 NA non-coding upstream 279009 17809141 ~ 17831690 (-)
G327367 plg non-coding upstream 301902 17832034 ~ 17834859 (-)
G325960 LOC106607776 other downstream 853134 16646755 ~ 16662881 (-)
G325696 NA other downstream 1175308 16339332 ~ 16340707 (-)
rnf217 rnf217 other downstream 1411327 16019428 ~ 16125180 (-)
G324432 NA other downstream 2261007 15253864 ~ 15255008 (-)
G323167 prs27 other downstream 3328844 14128489 ~ 14187171 (-)
G327409 LOC106607793 other upstream 265058 17795190 ~ 17800469 (-)
LOC110522229 LOC106607809 other upstream 753645 18022013 ~ 18286490 (-)
G328236 NA other upstream 916451 18446583 ~ 18447030 (-)
G328760 NA other upstream 1264974 18795022 ~ 18862375 (-)

Expression


G327268 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G327268 Expression in each Bioproject

Bar chart with 16 bars.
G327268 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network